The influence of carotenoid biosynthesis modification on the Fusarium culmorum and Fusarium oxysporum resistance in flax

The influence of carotenoid biosynthesis modification on the Fusarium culmorum and Fusarium oxysporum resistance in flax

Physiological and Molecular Plant Pathology 76 (2011) 39e47 Contents lists available at ScienceDirect Physiological and Molecular Plant Pathology jo...

547KB Sizes 1 Downloads 35 Views

Recommend Documents

Circular dichroism of fusarium lipoxygenase from Fusarium oxysporum
In the Soret region, a large negative trough at 427.5 nm of the oxidized Fusarium lipoxygenase between large positive pe

Influence of temperature on zearalenone production by regional strains of Fusarium graminearum and Fusarium oxysporum in culture
Zearalenone production by Fusarium graminearum and Fusarium oxysporum was studied under two temperature conditions. Incu

Gibberellin biosynthesis and gibberellin oxidase activities in Fusarium sacchari, Fusarium konzum and Fusarium subglutinans strains
Several isolates of three Fusarium species associated with the Gibberella fujikuroi species complex were characterized f

Nitric oxide reductase (P450nor) from Fusarium oxysporum
In the present review we wanted to highlight the characteristic features of cytochtome P450 NADH-NO reductase (P450nor)

Lactones 1. Hydroxylation of dihydro-β-campholenolactone by Fusarium culmorum
The stereospecific hydroxylation of racemic dihydro-β-campholenolactone (1) by several fungal strains has been evaluated

Isolation of cytoplasmic membranes of Fusarium culmorum protoplasts
Fusarium culmorum protoplasts were obtained by cell wall digestion with microbial lytic enzymes. The nature of the membr

Biosynthesis of size controlled silver nanoparticles by Fusarium oxysporum, their antibacterial and antitumor activities
The biosynthesis method is thought to be clean, nontoxic and environmentally acceptable. Many microorganisms produce ext

Physiological and Molecular Plant Pathology 76 (2011) 39e47

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp

The influence of carotenoid biosynthesis modification on the Fusarium culmorum and Fusarium oxysporum resistance in flax A. Boba a, A. Kulma a, K. Kostyn a, M. Starzycki b, E. Starzycka b, J. Szopa a, * a b

Faculty of Biotechnology, University of Wroclaw, Przybyszewskiego 63, 51-147 Wroclaw, Poland Pant Breeding and Acclimatization Institute IHAR, Research Division, Strzeszynska 36, 60-479 Poznan, Poland

a r t i c l e i n f o

a b s t r a c t

Article history: Accepted 17 June 2011

Flax engineering to yield increased resistance to pathogens is the goal of this study. Since carotenoids act as antioxidants it is thus postulated that the accumulation of a higher quantity of these compounds in the transgenic plants might improve their resistance to pathogen infection. Our approach was based on the generation of transgenic flax overproducing carotene and analysis of its susceptibility to Fusarium infection. For transformation bacterial gene e crtB was used. As expected, transgenic plants showed increased resistance against pathogen infection. The impact of carotenoids on plant resistance to infection was verified by generation and analysis of transgenic flax with decreased content of carotene. The transgenic plants were obtained by suppression of endogenous flax gene coding for lycopene b-cyclase. Plant analysis revealed decrease in carotene content, however, an unexpected increase in resistance against Fusarium infection was detected. Further analysis of metabolites in the plants revealed that an increase in accumulation of other terpenoids and tocopherols, squalene and menthol were among them. Thus, it is suggested that repression of carotene synthesis results in the redirecting of substrates to other branches of isoprenoids synthesis. We conclude that a general level of antioxidants rather than the presence of any particular compound is the most important factor in resistance of the flax plant to pathogen infection. Ó 2011 Elsevier Ltd. All rights reserved.

Keywords: Flax Carotenoids Terpenoids Fusarium Linum usitatissimum L

1. Introduction Carotenoids are an important group of secondary plant metabolites. These colored compounds are responsible for red, orange, and yellow coloration in many plants, microorganisms, and animals, although the last group is not capable of producing them, and can only obtain them from food. Over 700 different carotenoids have been identified [1,2]. From a chemical point of view, carotenoids are hydrophobic isoprenoid compounds. In most cases they possess a C-40 skeleton with system-conjugated double bonds [3], with other groups like epoxy-, hydroxyl-, and keto-types also present [4]. The synthesis of carotenoids is well recognized (Fig. 1). The precursors for synthesis are C5 IPP molecules, four of which are converted to geranyl geranyl pyrophosphate (GGPP; C20). GGPP is a precursor for the synthesis of not only carotenoids, but also of giberellic acid, chlorophyll, and tocopherols [3]. In the carotenoid synthesis pathway, two molecules of GGPP are condensed to phytoene by phytoene synthase [4]. Next, through four desaturation

* Corresponding author. E-mail address: [email protected] (A. Boba). 0885-5765/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.pmpp.2011.06.002

reactions, phytofluene, zeta-carotene, neurosporene, and lycopene are produced, this last one being the first colored compound on carotenoid synthesis pathway. In plants there are two enzymes involved in desaturation reaction, phytoene desaturase and zetacarotene desaturase, while in bacteria all four reactions are conducted by a single enzyme coded by the crtI gene. The desaturation reaction introduces carbon-carbon double bonds, which are essential for carotenoid function. A linear compound of lycopene undergoes cyclization in two possible ways. If two b-rings are provided by the enzyme lycopene b-cyclase, b-carotene is produced, whereas if one ring is the b-type and the second produced by lycopene 3-cyclase, a-carotene is created. b-carotene is a precursor of different carotenoids like xanthophylls, and a-carotene is converted to lutein, the main carotenoid component of thylakoid membranes in green plants [5]. In plants, carotenoids have many important functions. The major role is protection against photo-damage during photosynthesis. They absorb energy, preventing the creation of reactive oxygen species. They also possess the ability to quench singlet oxygen produced in photosynthesis [2]. As a component of biomembranes they protect phospholipids from peroxydation caused by free radicals that could be produced under various

40

A. Boba et al. / Physiological and Molecular Plant Pathology 76 (2011) 39e47

Fig. 1. The carotenoid biosynthesis pathway in plants and bacteria.

abiotic and biotic situations of stress [1]. One of the most stressogenic, biotic conditions for a plant is a pathogen attack. Flax plants are attacked by many pathogens; the most common of which are Fusarium culmorum, and Fusarium oxysporum. As a first response to pathogenic attack, plant cells generate free radicals (the so-called “oxidative burst”) leading to cell death, which limits pathogen spread [6]. It is also a signal for the production of some antimicrobial agents like phytoalexins and the synthesis of various phenolic compounds located in cell walls [7]. Fusarium species also produce trichothecenes, which are mycotoxins causing disorders in growth and morphology of infected plants [3,8]. As antioxidants, carotenoids are capable of quenching the free radicals produced during a pathogen attack and can also decrease the effect of mycotoxins [9]. Considering these features of carotenoids, we expected that carotenoid levels would play an important role in resistance to Fusarium infection. Since there is no data available on carotenoids’ role during infection, we decided to study this problem using a (the?) transgenic plant approach. Transgenic flax which overexpresses the key gene involved in carotenoid biosynthesis was generated. The gene crtB is derived from bacteria, and its effectivenes in carotenoid synthesis in several plant species including flax has been reported [10]. For comparison, plants with decreased carotenoid level were produced. There are two ways of gene expression reduction: RNAi methods, and homologous gene overexpression. For this study we applied the latter. To reduce the carotenoid content in flax, the plants were transformed with DNA that codes for lycopene cyclase in the sense orientation. In plants with increased carotenoid contents and plants with reduced carotenoid content, the susceptibility to pathogen attack was found to decrease. Establishing a correlation between carotenoid levels and susceptibility to infection is important as these compounds are used in food products and have recently become an object of genetic manipulation.

2. Materials and methods 2.1. Plant material Flax seeds (cv. Linola) were obtained from The Flax and Hemp Collection of the Institute of Natural Fibres, Poland. The transgenic and non-transgenic plants were grown in sterile condition on MS medium [11] with 2% sucrose and 0.8% agar, and in a greenhouse under a 16 h light (21  C), 8 h dark (16  C) regime. 2.2. Transgenic plant construction For carotenoids biosynthesis reduction, the DNA coding for lycopene b-cyclase (LCB) from Arabidopsis thaliana was used. The sequence of lycopene b-cyclase was amplified with gene-specific primers on genomic DNA from A. thaliana (GenBank accession no. At3g10230), and cloned into a binary vector. This sequence exhibits a high similarity to the flax LCB gene (74%). For carotenoid overexpression, the bacterial crtB gene was used. The sequence of the crtB gene (GenBank accession no. D90087) from Erwinia uredovora was obtained from genomic DNA and joined to a transit peptide. Both genes were under the control of a constitutive 35S promoter from the CaMV virus and OCS terminator. The vectors were introduced into Agrobacterium tumefaciens strain C58:pGV2260. Two week-old hypocotyls were cut and submerged in MS medium with a 24 h Agrobacterium culture for two days. Then, the hypocotyls were rinsed with water and transferred onto MS/agar plates supplemented with 1 mg/l BAP, 0.05 mg/l NAA, 50 mg/l kanamycin, and claforan to eliminate bacteria. The calli were transferred into shoot induction medium every 7 days [12]. 2.3. Preselection and selection of transgenic plants For preselection, genomic DNA was isolated from control and transgenic plants; it was used as a template for PCR analysis of [the/

A. Boba et al. / Physiological and Molecular Plant Pathology 76 (2011) 39e47

a] marker gene (nptII). Primers specific to a 475-bp fragment of the gene (F:CCGACCTGTCCGGTGCCC, R: CGCCACACCCAGCCGGCC) were applied. Selection of transgenic plants was based on respective mRNA analysis. CrtB plants (expressing crtB gene) were selected by means of bacterial crtB mRNA detection in semiquantitative PCR with gene-specific primers (F: AGATGCACGAACCGGCGTTT, R: AGCAGCA GCGTTAATTTTTCGG) and total RNA as template. Total RNA was isolated using an A&A Biotechnology kit, according to the manufacturer’s manual. Genomic DNA was removed (Invitrogen, Deoxyribonuclease I, Amplification Grade) and cDNA synthesis was performed (Invitrogen, SuperScript II Reverse Transcriptase). Genespecific primers were used to select transgenic plants. L plants (expressing AtLCB gene in sense orientation) were selected by means of endogenous (newly cloned flax gene for purposes of this work) LCB mRNA detection in real-time PCR with gene-specific primers (F: CATAAAGGAATTAACGGAGACG, R:CTTGTT GCAGGCAAATCA) and cDNA as template. The transcript level was assayed in LightCycler 2.0 instrument using A&A Biotechnology Master Mix SYBR. As a reference gene, a 150-bp fragment of the Flax actin gene (GenBank accession no. AY857865) was used (F: TGACA TCAGGAAGGACCTTT, R: CTCCAATCCAGACACTGTATTT). 2.4. Cloning of flax LCB gene In order to obtain the sequence of the flax LCB gene (GenBank accession no. FJ169892), different plant lycopene cyclase genes were aligned, and degenerated primers were designed (F e TGGC CHAAYAAYTAYGGTGT; R e CCATGCCARTAACGDGGYTC). Gradient PCR (from 42e52  C) was performed for the most homologous region, and the obtained 1000-bp fragment was sequenced. 2.5. Isolation of plant carotenoids for analysis 150 mg of fresh tissue was disrupted with a mortar and pestle with tetrahydrofurane (THF), celite, and magnesium carbonate. The extract was passed through a funnel and procedure was repeated until color was completely lost. The extracts were mixed and dried under nitrogen. The samples were dissolved in 150 mL of THF stabilized with BHT. The extracts were stored in 70  C. 2.6. UPLC analysis The chromatography analysis was performed using Acquity UPLC Water with a photodiode detector. Measurements were conducted at 475 nm. The sample temperature was set to 4  C, and the column temperature was set to 15  C. A 1.5-mL sample was applied to an Acquity UPLC BEH C18 column (2.1  50 mm, 1.7 mm). The mobile phase was passed through the column at a flow rate of 0.15 mL/min. The mobile phase consisted of two components, designated A (85% acetonitryle: 12.5 tetrahydrofuran: 2.5 water), and B (100% acetonitryle). The column was eluted for 11 min with 100% A, and then changed for 1 min to 100% B, and returned for 1 min to 100% A. A photodiode array (PDA) was used to detect UVevisible absorption between 210 and 500 nm. The compounds were identified and quantified using standards. 2.7. Infection tests on seedlings The fungi were grown for 7 days at 18  C on potatoedextroseeagar (PDA) medium. Flax seeds were sterilized with 96% ethanol, rinsed with water three times, and placed on petri dish with MS medium. After 7 day growth, the seedlings were transferred onto a medium with F. culmorum or F. oxysporum. After 10e14 days, the number of infected plants was counted and

41

percentage level of infection in comparison to that for a nontransgenic line was calculated [13]. 2.8. Infection tests on extracts Mixture of 50% PDA, 50% water, and 0.5% agar was prepared. 150 mL of PDA was mixed with 150 mL of plant extract and cylindrical agar blocks were formed using 1-mL pipette tips. For the control, PDA was mixed with water. Agar blocks for both, the extracts and the control, were placed on petri dishes. The inoculums with F. oxysporum or F. culmorum were placed on the top of each agar block. Fusarium growth was measured after four days. 2.9. GC-MS analysis Frozen tissue (100 mg) from tissue culture-grown plants was powdered in liquid nitrogen and extracted with MeOH (1400 mL). The samples were heated for 15 min at 70  C, and centrifuged for 10 min at 14,000 rpm. Then 1500 mL of water was added to the samples, which were then extracted with 750 mL of CHCl3. The portion of the water phase was dried under vacuum and used for derivatisation. An internal standard (ribitol, 120 mg/g FW) was added to the homogenate sample. The dried extract was mixed with methoxyamine hydrochloride (20 mg/mL) and incubated for 120 min at 37  C. Then the sample was derived with 70 mL N-methyl-N-trimethylsilyltrifluoroacetamide at 37  C for 30 min, and analyzed using GC-MS. The GC-MS system consisted of a GC 8000 gas chromatograph, an AS 2000 auto-sampler, and a Voyager quadrupole mass spectrometer (ThermoQuest, Manchester, UK). The chromatograms and mass spectra were evaluated using the MASSLAB program (ThermoQuest, Manchester, UK). The retention time and mass spectra library for peak quantification of metabolite derivatives was implemented within the MASSLAB method format. 2.10. TBARS determination The level of thiobarbituric acid-reactive substances (TBARS) in the samples was determined. Flax oil samples (4 mL) from control and transgenic seeds were oxidized at 140  C for up to 40 min. Two mL of reagent A (15% trichloroacetic acid and 0.37% thiobarbituric acid in 0.25 M HCl) was added and the mixture was thoroughly blended. Test tubes containing the samples were stoppered with glass marbles, heated at 100  C for 15 min, cooled under running tap water, and centrifuged for 10 min at 2000 g. The absorbance was measured at 535 nm using a spectrophotometer (Cecil CE2020). The reference blank contained the TBA reagent. 2.11. Determination of antioxidant capacity Antioxidant activity was measured using chemiluminescence method. The extracts from the transgenic lines, as well as the control were diluted from 1000 to 15,000 times with water and directly analyzed. The experiments were performed in a final volume of 250 mL on white microplates in a freshly prepared solution containing 0.1 M TriseHCl buffer (pH 9.0) and 4 mM AAPH (2,20 -azobis(2-amidinopropane) dihydrochloride). The luminol solution (100 mM) and diluted extracts were automatically injected. The photons produced in the reaction were counted on an EG&G Berthold LB96P microplate luminometer at 30  C. The antioxidant potential was defined as the amount of extract that inhibits luminol chemiluminescence by 50% and was expressed as IC50.

42

A. Boba et al. / Physiological and Molecular Plant Pathology 76 (2011) 39e47

2.12. TLC analysis Carotenoid extracts were prepared as described above. 20 mL of THF extract was resolved on silica gel 60 thin-layer chromatography (TLC) plate (Merck). The plate was developed with a 7:3 mixture of petroleum ether to acetone. 2.13. Statistical analysis To compare the level of tocopherols and terpenoid compounds with the antioxidative capacity of transgenic plants, Pearson correlation quotient was calculated. The correlations were significant at p < 0,05. The significance of differences were tested with Student’s t-test. All statistical calculations were performed using Statistica software (Statsoft). 3. Results 3.1. Transgenic plant generation and selection The hypocotyls and cotyledon explants of flax plants were transformed according to the Agrobacterium method with two binary vectors separately, and several pCrtB and L transgenic lines were generated. In order to preselect the obtained plants, PCR analysis on genomic DNA from transgenic lines was performed. A fragment of 475 bp was amplified in several regenerants (Fig. 2). Further selection of the crtB regenerants was performed by means of semiquantitative PCR method on a cDNA template, with primers specific to a 600 bp fragment of the crtB gene. Five transgenic lines were selected for further analysis (Fig. 3). In case of L plant (AtLCB expression) selection, a more sensitive real-time PCR analysis of endogenous flax LCB gene was used because the reduction in flax LCB gene expression was expected. We cloned it from flax plant first since the gene sequence was unknown. To accomplish this, several LCB genes were aligned and degenerated primers were constructed. PCR was conducted using these primers and flax DNA as a template. The 1 kb fragment from PCR was cloned and sequenced (sequence deposited in GenBank, accession no FJ169892) and showed high homology to known LCB gene sequences from other plant sources. The sequence was then used for LCB mRNA detection in transgenic flax. Several transgenic L lines upon transformation with AtLCB were found based on nptII gene marker expression, but only two of them, L9 and L18 showed clear repression of endogenous LCB gene expression by 48% and 64%, respectively (Fig. 4). Plants of these two lines were further analyzed and compared with crtB plants. 3.2. The analysis of carotenoid content The level of carotenoids was measured in the transgenic lines by UPLC method. In flax, there are two major carotenoid groups: bcarotene (carotene), and lutein (xanthophyll), and both were analyzed. As expected, the selected lines with LCB gene inhibition, showed decreased b-carotene levels. In line L18, which had the strongest inhibition of the endogenous LCB gene, there was almost

a 150 bp

b

wt 1

4

13 18

wt

4 13

21 22 24 30

nc

600 bp pl

1

18 21 22

24 30 nc

Fig. 3. Selection of crtB transgenic plants. (a) The agarose gel electrophoresis of the flax actin gene (GenBank accession no. AY857865; 150 bp). The fragment of the actin gene was amplified using specific primers, and a template was cDNA isolated from tissue-cultured flax plants. (b) The agarose gel electrophoresis of the bacterial crtB gene (GenBank accession no. D90087; 600 bp), amplified with specific primers on cDNA. wt e non-transgenic plant, nc e negative control (no DNA matrix), pl e positive control (plasmid); different transgenic lines are numbered.

2-fold decrease in carotene content in comparison to nontransgenic line (12 mg/g and 23 mg/g FW, respectively). In line L9, the b-carotene level was 15 mg/g FW. To verify whether the inhibition of carotene synthesis affects the synthesis of xanthophyll, the lutein content was measured. In both transgenic lines, the lutein content was decreased, and was 52 mg/g FW and 42 mg/g FW in L9 and L18, respectively, while its level in the control plant was 53 mg/g FW (Fig. 5a). Only the change in L18 line was statistically significant. In plants overexpresing the crtB gene, almost all selected lines showed increase in carotenoid level, both b-carotene and lutein. The best results were achieved for crtB22plant, which accumulated about 35% more b-carotene and 23.5% more lutein in comparison to the non-transgenic plants. In the remaining lines, the difference varied from 1% to 23% for lutein and 13% to 14% for b-carotene (Fig. 5b). The level of b-carotene was decreased in crtB4 line, however, the change was not statistically significant.

3.3. Resistance to F. culmorum and F. oxysporum infection The major fungal disease of flax is fusariose caused by the Fusarium species. It was expected that manipulating carotenoid synthesis might lead to changes in the resistance to pathogens. Carotenoids have antioxidant capacity and also play an important role in response to different stress situations. To our experience, an increased antioxidant capacity of plants usually meant a higher resistance to F. oxysporum and F. culmorum infection [14]. The extracts from plants with overproduction (crtB plants) and repression (L plants) of carotenoids were tested for the inhibition of growth of both types of pathogenic mycelia. The transgenic lines showed higher inhibition capacity. For crtB plants in the case of F. oxysporum infection, the level of its inhibition varied from 18% to 54%, while for F. culmorum from 9% to 78%. In case of L9 and L18 plants inhibition was respectively 36% and 50% for F. oxysporum, and 70% and 71% for F. culmorum (Fig. 6). The resistance to Fusarium infection of seedlings was also measured. In plant with repression of carotenoids synthesis, for both F. oxysporum and F. culmorum, the inhibition of mycelium growth was observed. Inhibition of F. culmorum reached 46% and 80% for L9 and L18, respectively. For F. oxysporum the inhibition was lower and ranged from 6% to 35% for L9 and L18, respectively (Fig. 7a, b). In case of crtB plants the inhibition was higher for

Fig. 2. The agarose gel electrophoresis of the neomycine phosphotransferase gene (npt II): 475 bp, amplified with specific primers on genomic DNA isolated from tissue-cultured transgenic flax plants overexpressing (a) e crtB, (b) e lcb gene; wt e non-transgenic plant, pl e positive control (plasmid); different transgenic lines are numbered.

A. Boba et al. / Physiological and Molecular Plant Pathology 76 (2011) 39e47

pathway. To analyze this, GC-MS measurement of the LCB repressed plants was performed. The GC-MS analysis showed that among the compounds which may play a role in the resistance to pathogens, there was an increase in the tocopherol alpha, and tocopherol beta contents. In case of the L18 line, the increase was almost 2-fold for tocopherol alpha, and 7-fold for tocopherol beta (Fig. 8a). Other terpenoid levels were also shown to change. In L18 the level of two more terpenoids, squalene and gibberellic acid, increased by 92% and 80%, respectively (Fig. 8b). In both the L lines there was also a higher level of menthol, which has antimicrobial activity [15]. For L9 it was about 50%, and for L18, 42% higher than in the linola control plants.

Endogenous LCB gene expression level 120 100

%

80

*

60

*

40

43

20 0 laloni

L9

L18

3.5. GC-MS analysis of the crtB transgenic lines

Fig. 4. The level of expression of the endogenous LCB gene. The analysis was performed using RT (Real Time) PCR on cDNA isolated from tissue-cultured flax plants, using primers specific to flax actin and lycopene b-cyclase genes; linola e nontransgenic line. Bars represent standard error (SE) of 6 independent experiments. Asterisks mark statistically significant differences at p < 0.05.

F. oxysporum infection and varied from 89% to 37%, while for F. culmorum from 18% to 2% (Fig. 7c, d).

The analysis demonstrated that the level of tocopherol alpha was somewhat elevated in crtB lines compared to the control, except the line 22, where the tocopherol alpha content decreased significantly to 77% (Fig. 9). No changes in other measured terpenoid levels, that is squalene, menthol, and gibberelic acid were observed. 3.6. Antioxidative capacity of LCB and crtB plants

3.4. GC-MS analysis of the LCB transgenic lines A decrease in the carotene content should lead to a reduction in the antioxidative capabilities of a plant, and thus to a decreased pathogen resistance. However, in the case of L transgenic lines, the resistance to Fusarium sp. was significantly elevated. It was expected that inhibiting the carotenoid synthesis pathway might result in the production of other compounds from the isoprenoid

a

To assess the level of antioxidative capacities of the obtained transgenic lines, both with the reduction of LCB gene, and with overexpression of crtB gene, TBARS analysis was performed. It was found that all the transgenic lines show a lower level of TBARS formation, thus elevating antioxidative properties (Fig. 10). Additionally, antioxidant activity of the transgenic lines was measured using the/a chemiluminescence method (Fig. 11).

β -carotene ug/gr FW

lutein ug/gr FW

30

60

25

50

20

40

*

* *

15

30

10

20

5

10 0

0 L9

linola

b

L18

linola

L9

β -carotene ug/gr FW 16

lutein ug/gr FW 30

*

14

*

L18

*

*

*

25

*

*

12 20

10

15

8 6

10

4 5

2

0

0 linola

Crtb4

Crtb18

Crtb21

Crtb22

Crtb24

linola

Crtb4

Crtb18

Crtb21

Crtb22

Crtb24

Fig. 5. The determination of the b-carotene and lutein levels by UPLC. (a) plants with repressed carotene synthesis (L9, L18); linola e non-transgenic line. (b) plants with overexpression of carotenoid compound synthesis (CrtB plant); linola e non-transgenic line. Bars represent standard error (SE) of 6 independent experiments. Asterisks mark statistically significant differences at p < 0.05.

44

A. Boba et al. / Physiological and Molecular Plant Pathology 76 (2011) 39e47

a

b

F. oxysporum

F. culmorum

120 100

250

80

200

*

*

150 %

%

60 40

*

crtB4

crtB18

20

* *

50

0

*

0

linola

c

crtB21

crtB22

crtB24

linola

crtB4

d

F. oxysporum

120

100

100

80

crtB18

*

%

*

crtB24

*

L9

L18

60

40

40

20

20

0

crtB22

*

80

60

crtB21

F. culmorum

120

%

*

100

*

*

*

0

Linola

L9

L18

Linola

Fig. 6. The percentage level of inhibition of Fusarium sp mycelia growth, assessed in extracts from plants with crtB gene overexpression (a, b) and lycopene cyclase reduction (c, d). Bars represent standard error (SE) of 6 independent experiments. Asterisks mark statistically significant differences at p < 0.05.

3.7. TLC analysis of the LCB transgenic lines

lines showed a higher level of pheophytin, the product of chlorophyll degradation (Fig. 12).

The carotenoids play an important role in chlorophyll protection. As the level of chlorophyll depends on the intensity of light exposure, which causes it to degrade and form pheophytin, the level of this compound was measured after treating the L transgenic plants with intense light. The decrease of carotene content indeed resulted in the degradation of chlorophyll. Both transgenic

a

3.8. Statistical analysis The antioxidative capacity of transgenic plants correlates with the amount of tocopherols and terpenoid compounds. For L9 transgenic line the antioxidative capacity correlated with squalen,

b

% of infection F. oxysporum 120

120

100

*

80

100 %

%

% of infection F.culmorum 140

60

80

*

60

40

40

20

20

*

0

0 linola

L9

c

linola

L18

d

% of infection F.oxysporum

120

100

100

*

*

60

*

40

*

*

20

*

80 60

*

40

L18

% of infection F.culmorum

120

80

L9

20 0

0

linola

crtB4

crtB18

crtB21

crtB22

crtB24

linola

crtB4

crtB18

crtB21

crtB22

crtB24

Fig. 7. The percentage of transgenic seedlings (L plant e a,b and crtB plant e c,d) infected with Fusarium sp in comparison to the non-transformants (linola). The results of the infection were estimated 10e14 days after inoculation. Bars represent standard error (SE) of 6 independent experiments. Asterisks mark statistically significant differences at p < 0.05.

A. Boba et al. / Physiological and Molecular Plant Pathology 76 (2011) 39e47

a

Tocopherol, alpha

45

Tocopherol, beta-

*

1000 900

250

800 700

200

600 500

%

%

300

150

400 300

100

200

50

100 0

0 linola

L9

b

L18

linola

L9

Squalene

L18

Gibberellic acid GA3

300

300

250

250

200

200

%

% 150

150

100

100

50

50 0

0 linola

L9

L9

linola

L18

L18

Menthol

*

180 160 140 120 100

% 80 60 40 20 0

linola

L9

L18

Fig. 8. The GC-MS determination of compounds levels in L plants. (a) tocopherol alpha and beta. (b) terpenoid compounds: squalene, gibberellic acid, and menthol. Bars represent standard error (SE) of 6 independent experiments. Asterisks mark statistically significant differences at p < 0.05.

Tocopherol, alpha

TBARS

160

*

140

120

*

*

120

100

*

80

%

%

*

80

100

60

60

40

40

20

20

0

*

*

*

* *

*

linola

crtB4

crtB18

crtB21

crtB22

crtB24

L9

L18

0 linola

CrtB4

CrtB18

CrtB21

CrtB22

CrtB24

Fig. 9. The GC-MS determination of tocopherol alpha levels in crtB plants. Bars represent standard error (SE) of 6 independent experiments. Asterisks mark statistically significant differences at p < 0.05.

Fig. 10. TBARS formation in transgenic flax oil extracted from the crtB and L (a) seeds in comparison to the wild-type control. Crude oil extracted from the seeds was heated for 40 min at 140  C. Data are mean TBARS levels from six repetitions measured spectrophotometrically at 535 nm expressed in percentage. Asterisks mark statistically significant differences at p < 0.05.

46

A. Boba et al. / Physiological and Molecular Plant Pathology 76 (2011) 39e47 IC50 120

100

80

%

* 60

40

*

*

*

*

20

*

0 linola

crtB4

crtB18

crtB21

crtB22

L9

L18

Fig. 11. The antioxidant potential of metabolites measured by chemiluminescence method. IC50 is the amount of extract which inhibits luminol chemiluminescence by 50%. Data expressed in percentage. Bars represent standard error (SE) of 6 independent experiments. Asterisks mark statistically significant differences at p < 0.05.

and menthol at the level of 0.94, and 0.95, respectively. In case of L18 transgenic line, the correlation between the antioxidative capacity and the amount of tocopherol b and gibberelic acid was 0.91 and 0.94, respectively. 4. Discussion Pathogen infection leads to the initiation of several different defense strategies in the infected plant. One of the first responses is programmed cell death (PCD), which restricts pathogen progress. The signal for PCD is an accumulation of reactive oxygen species produced during a so-called oxidative burst. Free radicals are toxic for pathogens and induce cell death, but they also play important role in the activation of other defense strategies like the production of pathogen resistance proteins (e.g. glucanases, chitinases, phytoalexins), the activation of systemic acquired resistance (SAR), and the induction of changes in the membrane potential and protein phosphorylation pattern [16,17]. All these processes cause limitations in the spreading of pathogens, but another aspect of fungal infection is the production of mycotoxins. Fusarium species produce trichotecenes, a group of sesquiterpenes. This group of compounds influences the growth and morphology of infected plants. In A. thaliana, they inhibited translation in the ribosomes, inactivated the production of brassinosteroids (which play an important role in the defense response), and caused the formation of reactive oxygen species. They also caused some visible effects in infected plants (e.g. dwarfism), and an inhibition of seed germination [8,18]. The most important problem caused by Fusarium

Fig. 12. The TLC analysis of the carotenoid extracts from non-transgenic (linola) and transgenic (L9 and L18) plants.

trichotecenes is the formation of reactive oxygen species, which could lead to the peroxidation of membrane lipids and lipoproteins. It was previously established that an increase in the antioxidative potential of plants, e.g. by introducing genes for the enzymes of the flavonoid biosynthesis pathway, has a positive effect on pathogen resistance [14]. As carotenoids were evidenced to have a large antioxidative capacity [19], we wanted to establish how the change in the level of those compounds influences plant pathogen resistance. To obtain the increase in the carotenoid content, we introduced the bacterial phytoene synthase crtB gene under the constitutive 35S promoter to flax plant, since it is known that this enzyme is the rate-limiting step in the carotenoid biosynthesis pathway [20]. As expected, the effect of the overexpression was an increase in the carotenoid content and thus an increased level of pathogen resistance. No decrease in the measured terpenoid content (gibberellic acid, squalene, menthol) was noted. Furthermore, the level of tocopherol a increased. Thus, the most important observation was that manipulating carotenoid content influences Fusarium resistance. In another flax plant, the repression of the endogenous LCB gene was performed and reduced b-carotene content achieved. The xanthophyl content in those plant was also decreased. This can be explained by the fact that lycopene beta-cyclase regulates the synthesis of both a- and b-carotene. a-carotene is the substrate for lutein synthesis, and thus LCB gene repression might lead to lutein content reduction [21]. Additionally, the reduced level of those compounds, which play an important role in the protection of chlorophyll, leads to a higher level of conversion of chlorophyll into its degradation product e pheophytin [22], which was detected by TLC analysis. No significant change in the chlorophyll level was detected in the transgenic lines in comparison to the control, therefore we suspect increased chlorophyll synthesis in L plants. Although the content of gibberellic acid, which plays an important role in plant growth regulation, increased in the transgenic lines, no morphological differences in comparison to the control plants were observed. However, decreasing the carotenoid level unexpectedly resulted in an increase plant resistance to the pathogen. In order to explain this unexpected result, the metabolic profile of the transgenic plants was carefully analyzed. GC-MS analyses revealed that in plants with reduction in carotenoid synthesis, a compensating mechanism might occur. We found that in line L18, which showed the highest inhibition of carotenoid synthesis, the accumulation of tocopherol a and b increased by about 2- and 7-fold, respectively. Also, in both lines, there was an increase in the level of menthol, the monoterpene which has antifungal activity [23]. It is known that many terpenes and terpenoids have antimicrobial activity [24]. It might suggest that repressing carotenoid synthesis caused either redirection of the substrates to produce other constituents of isoprenoid pathway [25,26] or somehow activates other branches of this pathway. Since accumulation of tocopherols, squalene and other terpenoids has been observed, the first suggestion seems to be more rational. This suggestion is further supported by the finding that expression of squalene synthase (newly cloned gene for the purpose of this study) was only slightly (15% and 30% for L9 and L18 plants, respectively) changed in L plants. Since some of the newly induced compounds are also antioxidants, they may play a similar to carotenoid role in responding to pathogen infection, but the mechanism of this is as yet unknown. Regardless of changes in the carotenoid level, the plants described in this paper had a higher antioxidant capacity. In the case of the overexpressing plants, it was caused by an increase in the carotenoid content, while in plants with carotenoid repression, the level of other antioxidant compounds, e.g. tocopherols, squalene and menthol increased. Those compounds have an ability to

A. Boba et al. / Physiological and Molecular Plant Pathology 76 (2011) 39e47

quench free radicals and reactive oxygen species produced in reaction to pathogen [9]. We demonstrated that carotenoids could play a role in the response to pathogen infection, but that they are not essential. The reduction in the level of carotenoids did not decrease pathogen resistance, because it changed the metabolite flow within the isoprenoid pathway, redirecting it from carotenoid synthesis toward tocopherol and other isoprenoid compound production [23]. This is also supported by the observation that in case of crtB22 line, which shows decreased level of tocopherol a, the effect of the extract is not inhibitory toward Fusarium mycelium. Our results thus suggest that a general level of antioxidants rather than the presence of any particular compound is the most important factor in resistance to pathogen infection. Despite the variation in the level of antioxidants, like tocopherols and carotenoids in both types of transgenic plants, the antioxidative potential is increased in both cases. This was proven by TBARS measurements and IC50 assays, resulting in the elevation of resistance to Fusarium attack. The reason for this in as yet unknown, however, we speculate that flax plant reacts to different Fusarium types using different mechanisms and producing different kinds of antioxidants. This observation results from the fact that plants with elevated carotenoid level are more resistant to F. oxysporum, and increased tocopherol content leads to a higher resistance to F. culmorum. Acknowledgements We would like to thank Dr. Wróbel-Kwiatkowska for the initial work with lycopene cyclase gene. We would like also acknowl ski from the Max Planck Institute, Golm, edged Dr. Je˛ drzej Szyman Germany, for his help in the GC-MS analysis. This study was supported by grant no. 2PO6A02029, PBZ-MNiI-2/1/2005 and NR 12000906 from the Ministry of Science and Higher Education. References [1] Strzalka K, Kostecka-Guga A, Latowski D. Carotenoids and environmental stress in plants: significance of carotenoid-mediated modulation of membrane physical properties. Russian Journal of Plant Physiology 2003;50: 168e72. [2] Jackson H, Braun CL, Ernst H. The chemistry of novel xanthophyll carotenoids. The American Journal of Cardiology 2008;101:S50e7. [3] Tanaka Y, Ohmiya A. Seeing is believing: engineering anthocyanin and carotenoid biosynthetic pathways. Current Opinion in Biotechnology 2008;19: 190e7. [4] Giuliano G, Tavazza R, Diretto G, Beyer P, Taylor MA. Metabolic engineering of carotenoid biosynthesis in plants. Trends in Biotechnology 2008;26:139e45. [5] Naik PS, Chanemougasoundharam A, Khurana SMP, Kalloo G. Genetic manipulation of carotenoid pathway in higher plants. Current Science 2003; 85:1423e30. [6] De Gara L, Pinto MC, Tommasi F. The antioxidant systems vis-à-vis reactive oxygen species during plantepathogen interaction. Plant Physiology and Biochemistry 2003;41:863e70.

47

[7] Lozovaya VV, Lygin AV, Li S, Hartman GL, Widholm JM. Biochemical response of soybean roots to Fusarium solani f. sp. glycines infection. Crop Science 2004; 44:819e26. [8] Masuda D, Ishida M, Yamaguchi K, Yamaguchi I, Kimura M, Nishiuchi T. Phytotoxic effects of trichothecenes on the growth and morphology of Arabidopsis thaliana. Journal of Experimental Botany 2007;58:1e10. [9] Atroshi F, Rizzo A, Westermarck T, Ali-Vehmas T. Antioxidant nutrients and mycotoxins. Toxicology 2002;180:151e67. [10] Fujisawa M, Watanabe M, Choi SK, Teramoto M, Ohyama K, Misawa N. Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering with introduction of bacterial phytoene synthase gene crtB. Journal of Bioscience and Bioengineering 2008;105:636e41. [11] Murashige T, Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiologia Plantarum 1962;51:493e7. [12] Gamborg OL, Miller RA, Ojima K. Nutrient requirements of suspension cultures of soybean root cells. Experimental Cell Research 1968;50:151e8. [13] Starzycki M. Study on resistance of winter oilseed rape (Brassicanapus L.) to Leptosphaeria maculans (Desm.) Ces. et de Not./Phoma Lingam (Tode ex Fr.) Desm., pathogen causing stem cancer of Brassicas. Monografie i rozprawy naukowe; 1998:1.  ski J, Doermann P, Starzycki M, [14] Lorenc-Kukula K, Amarowicz R, Oszmian Ska1a J, et al. Pleiotropic effect of phenolic compounds content increases in transgenic flax plant. Journal of Agricultural and Food Chemistry 2005;53: 3685e92. [15] Dambolena JS, Lopez AG, Canepa MC, Theumer MG, Zygadlo JA, Rubinstein HR. Inhibitory effect of cyclic terpenes (limonene, menthol, menthone and thymol) on Fusarium verticillioides MRC 826 growth and fumonisin B1 biosynthesis. Toxicon 2008;51:37e44. [16] Wojtaszek P. Oxidative burst: an early plant response to pathogen infection. Biochemical Journal 1997;322:681e92. [17] Mittler R, Hallak Herr E, Orvar B, van Camp W, Willekens H, Inze D, et al. Transgenic tobacco plants with reduced capability to detoxify reactive oxygen intermediates are hyperresponsive to pathogen infection. Proceedings of the National Academy of Sciences of the United States of America 1999;96: 14165e70. [18] Nishiuchi T, Masuda D, Nakashita H, Ichimura K, Shinozaki K, Yoshida S, et al. Fusarium Phytotoxin Trichothecenes have an elicitor-like activity in Arabidopsis thaliana, but the activity differed significantly among their molecular species. Molecular PlanteMicrobe Interactions 2006;19:512e20. [19] Stahl W, Sies H. Antioxidant activity of carotenoids. Molecular Aspects of Medicine 2003;24:345e51. [20] Tao N, Hu Z, Liu Q, Xu J, Cheng Y, Guo L, et al. Expression of phytoene synthase gene (Psy) is enhanced during fruit ripening of Cara Cara navel orange (Citrus sinensis Osbeck). Physiology and Biochemistry 2007;26:837e43. [21] Kim J, DellaPenna D. Defining the primary route for lutein synthesis in plants: the role of Arabidopsis carotenoid b-ring hydroxylase CYP97A3. Proceedings of the National Academy of Sciences of the United States of America 2006; 103:3474e9. [22] Vishnevetsky M, Ovadis M, Vainstein A. Carotenoid sequestration in plants: the role of carotenoid-associated proteins. Trends in Plant Science 1999;4: 232e5. [23] Lucini EI, Zunino MP, Lopez ML, Zygadlo JA. Effect of monoterpenes on lipid composition and sclerotial development of Sclerotium cepivorum Berk. Journal of Phytopathology 2006;154:441e6. [24] Cowan M. Plant products as antimicrobial agents. Clinical Microbiology Reviews 1999;12:564e82. [25] Lindgren LO, Stålberg KG, Höglund AS. Seed-specific overexpression of an endogenous Arabidopsis Phytoene synthase gene results in delayed germination and increased levels of carotenoids, chlorophyll, and abscisic acid. Plant Physiology 2003;132:779e85. [26] Fray RG, Wallace A, Paul PD, Valero D, Hedden P, Bramley PM, et al. Constitutive expression of a fruit phytoene synthase gene in transgenic tomatoes causes dwarfism by redirecting metabolites from the gibberellin pathway. The Plant Journal 1995;8:93e701.