Selective effects of neonatal handling on rat brain N-methyl-d -aspartate receptors

Selective effects of neonatal handling on rat brain N-methyl-d -aspartate receptors

Neuroscience 164 (2009) 1457–1467 SELECTIVE EFFECTS OF NEONATAL HANDLING ON RAT BRAIN N-METHYL-D-ASPARTATE RECEPTORS A. STAMATAKIS,a1 E. TOUTOUNTZI,b...

1017KB Sizes 0 Downloads 5 Views

Neuroscience 164 (2009) 1457–1467

SELECTIVE EFFECTS OF NEONATAL HANDLING ON RAT BRAIN N-METHYL-D-ASPARTATE RECEPTORS A. STAMATAKIS,a1 E. TOUTOUNTZI,b1 K. FRAGIOUDAKI,b E. D. KOUVELAS,b,c F. STYLIANOPOULOUa AND A. MITSACOSb*

It is well known that early experiences, particularly the mother–infant interaction, influence brain development and have long-term consequences for adult behavior, including emotionality and cognitive abilities. An experimental paradigm employed to study the effects of early experiences is neonatal handling, in which the pups are separated from their mother briefly (15 min daily) during the first 3 weeks of life (Levine, 1957). Notably the separation from the mother is short, and upon return of the pups to the nest the mother expresses increased maternal care towards them (Levine, 1994; Liu et al., 1997; Pryce et al., 2001; Fenoglio et al., 2006). Neonatal handling has been shown to alter the programming of hypothalamic–pituitary–adrenal (HPA) axis function, in such a way that the ability of the adult organism to respond, cope and adapt to stressful stimuli is increased (Levine, 1957; Meaney and Aitken, 1985; Meaney et al., 1991; Meerlo et al., 1999; FernandezTeruel et al., 2002; Fenoglio et al., 2006). As a consequence, handled rats show less fear and anxiety in novel environments, more exploratory behavior, and lower emotionality (Meaney et al., 1991; Fernandez-Teruel et al., 1997; Vallée et al., 1997; Meerlo et al., 1999). Since a properly regulated stress response and adaptability are prerequisites for learning and memory (Joels et al., 2006), one would expect that neonatal handling would result in better cognitive abilities. Indeed it has been shown that in adulthood neonatally handled rats show improved performance in several types of hippocampal-dependent learning paradigms, as in the two-way active avoidance (Escorihuela et al., 1994; Pryce et al., 2003), in the contextual fear conditioning (Beane et al., 2002) and in spatial tasks, including the Morris water maze (MWM) (Wong and Jamieson, 1968; Huot et al., 2002; Fenoglio et al., 2005). During aging the beneficial effects of neonatal handling are even more evident, as handled rats lose fewer hippocampal neurons (Meaney et al., 1991), and perform better in the spatial task of the MWM, compared to the non-handled rats (Meaney et al., 1988; Fernandez-Teruel et al., 1997). It is well known that N-methyl-D-aspartate (NMDA) receptors have a pivotal role in synaptic plasticity (Rao and Finkbeiner, 2007) and that they underlie the molecular events leading to the induction of long-term synaptic plasticity in the rodent hippocampus essential for spatial learning and memory (Nakazawa et al., 2004). These tetrameric receptors consist of two obligatory, channel-forming, NR1 subunits and two regulatory subunits, usually a combination of NR2A and NR2B. The subunit composition defines many receptor properties essential for synaptic plasticity. NR2B-containing differ from NR2A-containing receptors in

a Biology–Biochemistry lab, Faculty of Nursing, University of Athens, 11527 Athens, Greece b Department of Physiology, Faculty of Medicine, University of Patras, 26500 Patras, Greece c

Cozzika Foundation, Souidias 69-71, 11521 Athens, Greece

Abstract—Neonatal handling, an experimental model of early life experiences, is known to affect the hypothalamic–pituitary–adrenal axis function thus increasing adaptability, coping with stress, cognitive abilities and in general brain plasticity-related processes. A molecule that plays a most critical role in such processes is the N-methyl-D-aspartate (NMDA) receptor, a tetramer consisting of two obligatory, channel forming NR1 subunits and two regulatory subunits, usually a combination of NR2A and NR2B. Since the subunit composition of the NMDA receptor affects brain plasticity, in the present study we investigated the effect of neonatal handling on NR1, NR2A and NR2B mRNA levels using in situ hybridization, and on NR2B binding sites, using autoradiography of in vitro binding of [3H]-ifenprodil, in adult rat limbic brain areas. We found that neonatal handling specifically increased NR2B mRNA and binding sites, while it had no effect on the NR1 and NR2A subunits. More specifically, neonatally handled animals, both males and females, had higher NR2B mRNA and binding sites in the dorsal CA1 hippocampal area, as well as the prelimbic, the anterior cingulate and the somatosensory cortex, compared to the non-handled. Moreover NR2B binding sites were increased in the dorsal CA3 area of handled animals of both sexes. Furthermore, neonatal handling had a sexually dimorphic effect, increasing NR2B mRNA and binding sites in the central and medial amygdaloid nuclei only of the females. The neonatal handling-induced increase in the NR2B subunit of the NMDA receptor could underlie the higher brain plasticity, which neonatally handled animals exhibit. © 2009 IBRO. Published by Elsevier Ltd. All rights reserved. Key words: early handling, early-life experiences, NMDA receptor subunits, brain plasticity, in situ hybridization, autoradiographic in vitro binding.

1 A. Stamatakis and E. Toutountzi contributed equally to the work. *Corresponding author. Tel: ⫹30-2610-969156; fax: ⫹30-2610-997215. E-mail address: [email protected] (A. Mitsacos). Abbreviations: AC, anterior cingulate; ANOVA, analysis of variance; BLA, basolateral amygdaloid nucleus; CA1, field 1 of Ammon’s horn; CA3, field 3 of Ammon’s horn; CeA, central amygdaloid nucleus; DG, dentate gyrus; HPA, hypothalamic–pituitary–adrenal; IL, infralimbic; MeA, medial amygdaloid nucleus; NMDA, N-methyl-D-aspartate; Pir, piriform cortex; PL, prelimbic; PND, post-natal day; RT, room temperature.

0306-4522/09 $ - see front matter © 2009 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2009.09.032

1457

1458

A. Stamatakis et al. / Neuroscience 164 (2009) 1457–1467

their longer current duration, their greater Ca⫹2 conductance and thus currents with more contribution of Ca2⫹ ions, and their coupling to intracellular signaling partners important for plasticity (for review, see Cull-Candy and Leszkiewicz, 2004). The NR2A/2B ratio is not fixed at synapses but changes with development, sensory experience, and synaptic plasticity (for review, see Kopp et al., 2007; Yashiro and Philpot, 2008). For example, in sensory pathways, the developmental shift from NR2B to NR2A can be postponed by sensory deprivation (Philpot et al., 2001). Based on the above, we developed the hypothesis that NMDA receptor subunit levels would be modified as a result of neonatal handling. We further hypothesized that handling-induced effects would probably be sexually dimorphic since it has been previously shown that neonatal handling has a number of sexually dimorphic effects (Smythe et al., 1994; Papaioannou et al., 2002a,b; Park et al., 2003; Stamatakis et al., 2006) and most interestingly influences cognitive abilities differentially in the two sexes (Stamatakis et al., 2008). Therefore, in the present study, we investigated the effect of neonatal handling on the mRNA expression of NMDA receptor subunits NR1, NR2A and NR2B, as well as [3H] ifenprodil (an NR2B antagonist) specific binding levels, in adult rat limbic system structures, such as the hippocampus, the amygdala, and the prefrontal [prelimbic (PL), infralimbic (IL), and anterior cingulate (AC)] and piriform cortices, as well as the somatosensory cortex, brain areas known to be affected by neonatal handling (Meaney and Aitken, 1985; Mitchell et al., 1990; Meaney et al., 1996; Pham et al., 1997; Jaworski et al., 2005; Garoflos et al., 2007, 2008). The occipital cortex (visual-processing areas), was also included in our study as a “control” area, in which we did not expect to observe any effects of handling.

EXPERIMENTAL PROCEDURES Animals Wistar rats of both sexes reared in our laboratory were kept under standard conditions (24 °C; 12-h light/dark cycle, lights on at 8:00 AM) and received food and water ad libitum. Virgin females were exposed to stud males and pregnancy was determined by the presence of sperm in the vaginal smear (day 0 of pregnancy). Prior to birth litters from each dam were randomly assigned to either the handled or non-handled category (five litters in each of the two categories). Neither the litter size nor the sex ratio was different among the litters employed in the different animal groups [average litter size (mean⫾SEM (standard error of the mean): non-handled litters 9⫾0.6 (range, 7–11), handled litters 9.2⫾0.3 (range, 8 –10); average sex ratio (males: females, mean⫾SEM): non-handled litters 1.06⫾0.20, handled litters 1.05⫾0.15]. Litters were not culled, since it has been shown that litter size within this range (5–18) does not affect maternal behavior (Deviterne et al., 1990; Champagne et al., 2003). The day of birth was defined as postnatal day 0 (PND0). Three to four animals of the same sex, litter and category (handled or non-handled) were placed per cage following weaning and kept under standard housing conditions (see above). A total of 20 adult animals (PND90 –PND100) were used in this study: five male non-handled, five male handled, five female non-handled, five female handled (one animal of each sex from

each litter was employed). All animal experimentations were carried out in agreement with ethical recommendation of the European Communities Council Directive of November 24, 1986 (86/ 609/EEC). All efforts were made to minimize the number of animals used and their suffering.

Neonatal handling The neonatal handling protocol employed was as originally described by Levine (1957). Each pup of a litter was removed from the nest for 15 min daily during the neonatal period and placed together with its littermates in a separate container lined with paper towels and heated by an infrared lamp. In the present experiments handling was performed from the first postnatal day (PND1) until weaning (PND22). Specifically, every day between 9:00 –10:00 AM mothers of the pups to be subjected to handling were removed from their home cages and temporarily placed separately into cages (the same cage for each mother every day for the duration of 22 days of handling). Their pups were then removed and placed into plastic containers, lined with paper towels. After 15 min the pups, and then their mothers, were returned to their home cages. Nonhandled pups were left undisturbed with their mothers in their home cage until weaning.

Tissue preparation When animals were 90 –100 days old, they were deeply anesthetized with chloral hydrate, decapitated and brains were isolated and frozen in ⫺40 °C isopentane. Brain tissue was cut into sagittal 15 ␮m sections on a cryostat (Leica CM1500, Nussloch, Germany) at ⫺18 °C, collected on poly-L-lysine-coated slides and stored at ⫺70 °C until further processed. Each brain was used for both in situ hybridization (for NR1, NR2A and NR2B) and autoradiographic in vitro receptor binding experiments.

mRNA detection by in situ hybridization In situ hybridization was performed as previously described (Fragioudaki et al., 2003): Frozen sections were allowed to air-dry at room temperature (RT) and were then fixed for 5 min by immersion in 4% paraformaldehyde in phosphate-buffered saline (PBS; pH 7.4, 0.1 M, containing 0.1% diethylpyrocarbonate), rinsed in PBS and after dehydration in graded ethanols (70%, 95%) were kept in 95% ethanol (with 0.1% diethylpyrocarbonate) at 4 °C until use. Just prior to hybridization, sections were removed from ethanol and allowed to air-dry at RT. The oligodeoxyribonucleotide probes (Microchemistry Laboratory, FORTH, Crete, Greece) were complementary to the mRNAs encoding NR1, NR2A and NR2B subunits of rat NMDA receptors. The sequences of the synthetic oligonucleotides were: 5=⬎TTCCTCCTCCTCCTCACTGTTCACCTTGAATCGGCCAAAGGGACT⬍3= for NR1; 5=⬎AGAAGGCCCGTGGGGAGCTTTCCCTTTGGCTAAGTT⬍3=, for NR2A; 5=⬎GGGCCTCCTGGCTCTCTGCCATCGGCTAGGCACCTGTTGTAACCC⬍3=, for NR2B. No significant homologies other than the target sequences were found using the National Centre of Biotechnology Information BLAST network service. The oligonucleotide probes were diluted to a concentration of 0.3 pmol/ml and were 3= end-labelled with 35S-dATP (New England Nuclear, USA, specific activity 1200 Ci/mmol) by terminal transferase (Boehringer, Mannheim, Germany) to a specific activity of 2⫻107, 3⫻107 and 3⫻107 cpm/pmol for NR1, NR2A and NR2B subunits, respectively. Unincorporated nucleotides were removed by chromatography with Sephadex G-50 columns. Hybridization was performed in a solution containing 50% formamide (v/v), 4⫻ SSC (1⫻ SSC: 0.15 M sodium chloride, 0.015 sodium citrate), 10% dextran sulfate (w/v) and 10 mM dithiothreitol, with 1:100 labeled probe (final concentration of the

A. Stamatakis et al. / Neuroscience 164 (2009) 1457–1467 labeled probe 6⫻10⫺5 pmol/␮l). Tissue sections on slides were covered with 100 ␮l of hybridization solution, immediately covered with a strip of parafilm and incubated overnight (18 h) in a humid chamber at 42 °C. Nonspecific signal was determined by addition of 100-fold excess of unlabeled probe to the hybridization solution on some slides. Following hybridization, the parafilm was removed and sections were first rinsed in 1⫻ SSC at RT, washed in 1⫻ SSC for 20 min at 60 °C, dipped in 1⫻ SSC at RT, washed in 0.1⫻ SSC for 3 min at RT and finally dehydrated in 70%, 95% and 100% ethanol and allowed to air-dry at RT. For each mRNA, sections from all four animal groups (nonhandled male, handled male, non-handled female and handled female) were exposed to a BioMax MR film (Kodak). Exposure times varied depending on the subunit and on the labeling of the probe (ranging from 2 weeks to 3.5 months). After exposure, the films were developed in Kodak GBX developer.

1459

Statistical analysis Data were analyzed by two-way analysis of variance (ANOVA) with neonatal handling and sex as independent factors. When interactions between the independent factors were detected, separate one way ANOVAs followed by Bonferroni post hoc tests were performed in order to identify specific differences between groups. The level of statistical significance was set at 0.05. All tests were performed with the SPSS software (Release 10.0.1, SPSS, USA).

Photomicrograph production High-resolution images were produced from autoradiographic films, scanned using a CanoScan 8000F scanner (Canon, Japan). Composite photomicrographs were prepared with the Adobe Photoshop 7.0 (Adobe Systems, USA).

Autoradiographic determination of NR2B subunit NR2B binding density was evaluated using quantitative in vitro receptor autoradiography and the NR2B specific radioligand [phenyl-3H]-ifenprodil (55.5 Ci/mmol, PerkinElmer, USA) in the presence of 100 ␮M trifluoroperazine. Sections were pre-incubated in Tris–HCl buffer (50 mM Tris–HCl pH 7.4) at RT for 30 min. After preincubation, sections were incubated at RT for 2 h in 50 mM Tris–HCl buffer containing 15 nM (phenyl-3H)-ifenprodil. Incubation was followed by three washes (5 min each) in 50 mM Tris buffer (pH 7.4) at 4 °C. Sections were finally dipped in ice-cold ddH2O and dried with a stream of cold air. To determine nonspecific binding adjacent sections were incubated with 1 mM ifenprodil (Sigma Aldrich, USA) and the radioligand [Phenyl-3H]Ifenprodil. Tritium-sensitive film (MS-I, Kodak, USA) was exposed to labelled dried sections, along with plastic [3H]standards (American Radiolabeled Chemicals Inc., USA) for 1 month. All films were manually developed for 3 min in Kodak D-19 Developer (Kodak, France), fixed for 10 min in sodium fixer (Kodak, France), rinsed in distilled water and air-dried. In each assay brain sections from all four categories of animals (handled or non-handled, males and females) were processed concurrently.

Quantification of results Quantification of in situ hybridization. Regional intensities of hybridization signals were determined using an MCID–MI image analysis system (Imaging Research, Canada). For each subunit, measurements were taken for the total as well as for the nonspecific hybridization signal from each animal. The specific signal was determined by subtracting nonspecific from total signal. For each brain area, three to four sections, depending on the brain area, from each animal, spaced by 150 ␮m along the mediolateral axis, were quantified. To better visualize and discriminate between structures and boundaries, adjacent brain sections were stained with Cresyl Violet. All brain areas were identified using the rat brain atlas (Paxinos and Watson, 2007). Quantification of in vitro binding. Autoradiographs were scanned using a Cannon scanner (CanoScan 8000F, Canon, Japan) and quantitative analysis was done using the software package Scion Image 1.9.1 (Scion Corporation, USA). Binding levels were quantified in selected brain areas, as optical density. The mean optical density was converted to receptor density (fmoles/milligram tissue) according to the exposed 3H-labeled standards. For each brain area, three to four sections, depending on the brain area, from each animal, spaced by 150 ␮m along the mediolateral axis, were quantified. Specific binding was ⬎95% of the total binding. To better visualize and discriminate between structures and boundaries, adjacent brain sections were stained with Cresyl Violet. All brain areas were identified using the rat brain atlas (Paxinos and Watson, 2007).

RESULTS NR1 and NR2A mRNA expression In neonatally handled animals, the levels of NR1 or NR2A mRNA expression remained unchanged in all brain areas examined, compared to the non-handled animals (Tables 1, 2, respectively). NR2B mRNA expression and [3H] ifenprodil binding Hippocampus. Among the hippocampal areas studied (field 1 of Ammon’s horn (CA1), field 3 of Ammon’s horn (CA3) and dentate gyrus (DG) of dorsal and ventral hippocampus), we observed statistically significant increased levels of both NR2B mRNA and NR2B binding sites, as determined with [3H]ifenprodil specific binding, only in the CA1 area of the dorsal hippocampus in both male and female handled, compared to the respective non-handled rats (two-way ANOVA with handling and sex as the independent factors: Main effect of handling, F1,19⫽5.342, P⫽0.035 for the mRNA; F1,19⫽4.671, Table 1. NR1 mRNA levels in the brain of adult rats

CA1-d CA3-d DG-d CA1-v CA3-v DG-v CeA MeA BLA PL IL AC Pir Sm-out Sm-in Occ-out Occ-in

Male non-handled

Male handled

Female non-handled

Female handled

627⫾30 591⫾30 628⫾32 494⫾40 545⫾46 597⫾35 509⫾60 411⫾86 488⫾89 314⫾39 264⫾34 246⫾38 543⫾57 313⫾41 251⫾41 325⫾23 248⫾21

623⫾25 613⫾14 605⫾20 482⫾57 526⫾24 607⫾26 503⫾27 425⫾49 480⫾82 304⫾31 285⫾49 270⫾50 564⫾69 269⫾17 288⫾17 329⫾23 243⫾19

630⫾33 626⫾49 657⫾32 524⫾42 547⫾18 611⫾30 511⫾67 420⫾68 491⫾87 313⫾27 293⫾38 293⫾44 594⫾50 286⫾70 301⫾56 306⫾28 224⫾42

606⫾32 597⫾41 629⫾46 515⫾44 635⫾36 645⫾37 517⫾72 402⫾84 494⫾81 318⫾37 265⫾25 268⫾29 525⫾52 285⫾17 255⫾18 311⫾22 249⫾18

Mean⫾SEM of Average ROD of non-handled and handled male and female animals.

1460

A. Stamatakis et al. / Neuroscience 164 (2009) 1457–1467

on either NR2B mRNA or binding sites in the basolateral nucleus (BLA) (Tables 3, 4).

Table 2. NR2A mRNA levels in the brain of adult rats

CA1-d CA3-d DG-d CA1-v CA3-v DG-v CeA MeA BLA PL IL AC Pir Sm-out Sm-in Occ-out Occ-in

Male non-handled

Male handled

Female non-handled

Female handled

599⫾24 377⫾24 436⫾20 190⫾18 298⫾33 296⫾25 32⫾5 34⫾9 52⫾8 96⫾5 101⫾5 107⫾3 197⫾4 94⫾8 92⫾6 93⫾5 90⫾5

605⫾28 352⫾19 432⫾25 200⫾24 323⫾21 311⫾16 34⫾5 31⫾7 51⫾4 90⫾9 91⫾10 95⫾15 193⫾8 95⫾5 93⫾4 97⫾6 94⫾7

602⫾20 361⫾21 450⫾17 203⫾13 290⫾19 308⫾17 30⫾2 36⫾7 49⫾8 99⫾12 110⫾8 127⫾12 196⫾12 100⫾6 98⫾4 99⫾4 96⫾5

621⫾40 384⫾30 467⫾33 223⫾27 303⫾20 318⫾26 33⫾6 39⫾6 56⫾3 102⫾7 107⫾13 112⫾9 192⫾9 103⫾13 100⫾10 94⫾6 91⫾6

Mean⫾SEM of Average ROD of non-handled and handled male and female animals.

P⫽0.048 for the binding sites) (Figs. 1, 2). The increases in NR2B mRNA and binding sites were 10% and 30%, respectively. Moreover, the NR2B binding sites, as determined with [3H]ifenprodil specific binding, were also increased in the CA3 area of the dorsal hippocampus of handled animals of both sexes, compared to the respective non-handled, by 17% (two-way ANOVA, main effect of handling: F1,19⫽5.080, P⫽0.041) (Fig. 2). However, the levels of NR2B mRNA were not changed in the dorsal CA3 hippocampal area of handled animals (Table 3). In addition, no effect of handling was observed on either NR2B mRNA or binding sites in the dorsal DG, the ventral CA1, the ventral CA3, and the ventral DG (Tables 3, 4). Amygdaloid complex. Statistical analysis of the data for NR2B mRNA expression levels in amygdaloid nuclei by two-way ANOVA showed a significant handling⫻sex interaction (F1,19⫽20.486, P⬍0.001 for central amygdaloid nucleus (CeA); F1,19⫽8.701, P⫽0.012 for medial amygdaloid nucleus (MeA)). The levels of NR2B mRNA were increased in the CeA by 124% (P⬍0.05, post hoc test) and MeA by 40% (P⬍0.05, post hoc test) of female handled animals, whereas no significant alterations were detected in these same brain areas in the handled males, compared to the respective non-handled (Fig. 1). A similar statistical analysis regarding the levels of NR2B binding sites in amygdaloid nuclei also revealed a significant handling⫻sex interaction (F1,19⫽4.644, P⫽ 0.049 for CeA; F1,19⫽5.163, P⫽0.041 for MeA). The NR2B specific binding levels were increased in both the CeA (P⬍0.05, post hoc test) and MeA (P⬍0.01, post hoc test) amygdaloid nuclei of female handled animals, by 25% and 12%, respectively, while no differences were observed in these same brain areas in the handled males, compared to the respective non-handled (Table 3, Fig. 2). In addition, no effect of handling was observed

Cortical areas. Among the cortical areas studied (PL, IL, AC, Piriform, somatosensory, and occipital), handling resulted in statistically significant increased density of both NR2B mRNA and NR2B binding sites in the PL and AC prefrontal cortical areas (two-way ANOVAs with handling and sex as the independent factors, main effect of handling: PL: F1,19⫽6.832, P⫽0.020 for the mRNA; F1,19⫽ 6.411, P⫽0.024 for the binding sites; AC: F1,19⫽8.586, P⫽0.012 for the mRNA; F1,19⫽7.368, P⫽0.018 for the binding sites), as well as the outer and inner layers of the somatosensory cortex (Outer layers: F1,19⫽14.733, P⫽0.002 for the mRNA; F1,19⫽5.623, P⫽0.033 for the binding sites. Inner layers: F1,19⫽22.206, P⬍0.001 for the mRNA; F1,19⫽7.801, P⫽0.014 for the binding sites) of both males and females (Figs. 1 and 2). Moreover, the statistical analysis indicated that the density of NR2B mRNA was increased by handling in the piriform cortex (Pir) (two-way ANOVA, main effect of handling: F1,19⫽5.153, P⫽0.038) as well as the outer and inner layers of the occipital cortex (Outer layers: F1,19⫽25.439, P⬍0.001; Inner layers: F1,19⫽20.463, P⫽0.001) of handled animals of both sexes, compared to the respective non-handled (Fig. 1). Notably, the levels of NR2B binding sites were not changed by handling in these cortical areas (Table 4). In addition, no effect of handling was observed on either NR2B mRNA or binding sites in the IL (Tables 3 and 4). It should be mentioned that statistical analyses have shown a sex difference in the density of NR2B mRNA in the outer and inner layers of the somatosensory (two-way ANOVA, main effect of sex: Outer layers: F1,19⫽8.784, P⫽0.010; Inner layers: F1,19⫽11.421, P⫽0.004) and occipital cortex (Outer layers: F1,19⫽11.946, P⫽0.003; Inner layers: F1,19⫽4.793, P⫽0.047) with females having higher levels of NR2B mRNA than males. No sex difference has been identified in the levels of NR2B binding sites, in any brain area analyzed (Table 4).

DISCUSSION Neonatal handling, a widely employed experimental paradigm for the study of the effects of early experiences on brain function, has been shown to increase adaptability, the ability for learning and memory, as well as hippocampal LTP, processes reflecting brain plasticity. Since a key molecule mediating plasticity related processes is the NMDA receptor, we investigated herein the long-term effect of neonatal handling on the levels of NMDA receptor subunits NR1, NR2A and NR2B in the adult rat brain. In the present study using the specific antagonist of the NR2B subunit, ifenprodil, we have found selective increases in [3H]ifenprodil specific binding levels in the hippocampus, amygdala and cortex. This observation in NR2B binding levels reflects changes in the NMDA receptor channels that include the NR2B subunit, which are located either synaptically or extrasynaptically (Köhr, 2006). Furthermore, these changes could reflect either a change in subunit composition or an increase in the num-

A. Stamatakis et al. / Neuroscience 164 (2009) 1457–1467

1461

Fig. 1. Effects of neonatal handling on NR2B mRNA expression levels. (A) Bar graphs depicting the density [Relative Optical Density (ROD)] of NR2B mRNA in different brain areas. Bars represent means⫾SEM (n⫽5 animals in each group). *, **, *** statistically significant handling effects (* 0.01⬍P⬍0.05; ** 0.001⬍P⬍0.01; *** Pⱕ0.001 two-way ANOVAs with handling and sex as independent factors): handled animals of both sexes had more NR2B mRNA than the non-handled in the dorsal CA1 hippocampal area (CA1-d), in the prelimbic (PL), anterior cingulate (AC), piriform (Pir), somatosensory (outer and inner layers, Sm-out and Sm-in, respectively), and the occipital (outer and inner layers, Occ-out and Occ-in, respectively) cortices. #, ## statistically significant sex effects (# 0.01⬍P⬍0.05; ## 0.001⬍Pⱕ0.01 two-way ANOVAs with handling and sex as independent factors): female animals had more NR2B mRNA than males in both the outer and inner layers of the somatosensory and occipital cortices. §, §§§ statistically significant handling⫻sex interaction (§ 0.01⬍P⬍0.05; §§§ P⬍0.001): among females, the handled had more NR2B mRNA in the central (CeA) and medial (MeA) amygdaloid nuclei than the non-handled. (B) Representative autoradiographs of NR2B mRNA in situ hybridization in rat brain sagittal sections at a medial level showing the prefrontal cortex (top panels) and a lateral at the level of the amygdala (bottom panels). IL, infralimbic cortex, Str, Striatum.

ber of NMDA receptor channels. In the present study we have also observed increases of the NR2B mRNA, using in situ hybridization, but not of NR1 or NR2A in hippocampus, amygdala and cortex. Because NR1 mRNA was not affected by neonatal handling, it is likely that changes in the composition and channel properties rather than the number of NMDA receptors are the primary effect of neonatal handling on NMDA receptors. The selective increases in NR2B binding levels and the increase in NR2B mRNA are indicative of increased incorporation of NR2B into the NMDA receptor complex. This would allow NMDA receptors to increase the time window for detecting synaptic coincidence, since it is known that the recombinant NR1/NR2B complex in vivo shows longer excitatory postsynaptic potentials than the NR1/NR2A (Monyer et al., 1994; Flint et al., 1997). Thus the increases

in NR2B observed imply an increase in NMDA-mediated plasticity in the affected brain regions of the handled rats. Evidence for the critical role of the NR2B subunit in brain plasticity is provided by transgenic mice overexpressing NR2B in the forebrain. Activation of NMDA receptors in these mice leads to facilitation of synaptic potentiation in response to stimulation at 10 –100 Hz in the CA1 region of the hippocampus. These mice exhibit superior ability in learning and memory in various tasks, showing that NR2B is critical in gating the age-dependent threshold for plasticity and memory formation (Tang et al., 2001). Interestingly, the handling-induced increase of the NR2B functional subunit was observed in the CA1 and CA3 areas only of the dorsal hippocampus. Relevant to our results are the results of previous studies indicating that the hippocampus is functionally and anatomically differen-

1462

A. Stamatakis et al. / Neuroscience 164 (2009) 1457–1467

Fig. 2. Effects of neonatal handling on the levels of NR2B binding sites. (A) Bar graphs depicting the density (fmoles/mg tissue) of NR2B binding sites. Bars represent means⫾SEM (n⫽5 animals in each group). * statistically significant handling effects (* 0.01⬍P⬍0.05, two-way ANOVAs with handling and sex as independent factors): handled animals of both sexes had more NR2B binding sites in the dorsal (d) CA1 and CA3 hippocampal areas and the prelimbic (PL), anterior cingulate (AC), and somatosensory (outer and inner layers, Sm-out and Sm-in, respectively) cortices. § statistically significant handling⫻sex interaction (§ 0.01⬍P⬍0.05): among females, the handled had more NR2B binding sites in the central (CeA) and medial (MeA) amygdaloid nuclei than the non-handled. (B) Representative autoradiographs of NR2B binding sites in rat brain sagittal sections at a medial level showing the prefrontal cortex (top panels) and a lateral at the level of the amygdala (bottom panels). Str, Striatum.

tiated along its dorso–ventral axis. The cortical and subcortical connections of the dorsal and ventral hippocampus are different, with information derived from the sensory cortices entering mainly in the dorsal two-thirds to threequarters of the DG. In addition, the dorsal hippocampus has a preferential role in certain forms of learning and memory, notably spatial learning (for reviews see Moser and Moser, 1998; Banneman et al., 2004; Czerniawski et al., 2009). The selective upregulation of NR2B in the dorsal hippocampus of handled rats reported herein, might represent the mechanism underlying the increased ability for spatial learning (Wong and Jamieson, 1968; Huot et al., 2002; Fenoglio et al., 2005) and increased hippocampal LTP reported previously as a result of neonatal handling (Tang and Zou, 2002). It should be mentioned that the handling-induced increase in the NR2B subunit was observed at the level of both the mRNA and functional protein (as assessed by the binding levels) for the dorsal CA1

area, while for the dorsal CA3 only at the functional protein level. The latter result showing a discrepancy in the effect of handling on mRNA and functional protein levels could possibly reflect decreased turnover of the NR2B protein and/or an increased incorporation of NR2B containing NMDA receptors into the membrane, while NR2B gene transcription is not influenced. Similar results showing an effect of an experimental intervention on NR2B protein but not on mRNA levels have been obtained by Bajo et al. (2006). Notably, rearing in an enriched environment, which is known to have similar effects as neonatal handling, increasing plasticity related processes such as LTP and learning and memory (van Praag et al., 1999; Duffy et al., 2001), has also been shown to result in increased hippocampal NR2B levels (Bredy et al., 2004). On the other hand, maternal deprivation, which is detrimental for LTP (Gruss et al., 2008) and learning and memory (Garner et

A. Stamatakis et al. / Neuroscience 164 (2009) 1457–1467

1463

Table 3. NR2B mRNA levels in the brain of adult rats Male non-handled

Male handled

Female non-handled

Female handled

Handling effect

Sex effect

Handling X sex interaction

CA1-d

506⫾32

562⫾18

518⫾31

567⫾19

F1,19⫽5.342 P⫽0.035

F1,19⫽0.146 P⫽0.708

F1,19⫽0.021 P⫽0.887

CA3-d DG-d CA1-v CA3-v DG-v CeA

340⫾41 482⫾27 296⫾18 366⫾7 443⫾21 36⫾5

317⫾16 491⫾20 317⫾35 373⫾28 457⫾36 32⫾3

328⫾23 506⫾27 307⫾32 379⫾20 452⫾31 32⫾6

349⫾11 502⫾24 302⫾22 385⫾20 439⫾22 72⫾7

MeA

78⫾8

65⫾7

74⫾9

104⫾6

BLA PL

72⫾7 96⫾15

77⫾8 117⫾7

78⫾5 108⫾7

81⫾9 134⫾4

IL AC

90⫾3 98⫾9

94⫾6 115⫾7

97⫾3 108⫾3

104⫾7 132⫾8

Pir

250⫾12

279⫾16

257⫾15

309⫾22

Sm-out

132⫾11

151⫾5

145⫾6

179⫾5

75⫾7

87⫾4

82⫾2

110⫾6

143⫾4

162⫾2

155⫾4

185⫾8

89⫾3

105⫾4

93⫾3

121⫾9

Sm-in Occ-out Occ-in

F1,19⫽20.486 P⬍0.001 F1,19⫽8.701 P⫽0.012 F1,19⫽6.832 P⫽0.020

F1,19⫽2.630 P⫽0.127

F1,19⫽0.077 P⫽0.785

F1,19⫽8.586 P⫽0.012 F1,19⫽5.153 P⫽0.038 F1,19⫽14.733 P⫽0.002 F1,19⫽22.206 P⬍0.001 F1,19⫽25.439 P⬍0.001 F1,19⫽20.463 P⫽0.001

F1,19⫽3.623 P⫽0.079 F1,19⫽1.067 P⫽0.318 F1,19⫽8.784 P⫽0.010 F1,19⫽11.421 P⫽0.004 F1,19⫽11.946 P⫽0.003 F1,19⫽4.793 P⫽0.047

F1,19⫽0.177 P⫽0.681 F1,19⫽0.404 P⫽0.535 F1,19⫽1.307 P⫽0.272 F1,19⫽3.486 P⫽0.080 F1,19⫽1.212 P⫽0.291 F1,19⫽1.774 P⫽0.206

Mean⫾SEM of Average ROD of non-handled and handled male and female animals.

al., 2007; Benetti et al., 2009), results in decreased expression of NR2B in the hippocampus (Roceri et al., 2002; Pickering et al., 2006). Most relevant to our findings are the results showing that offspring of mothers exhibiting high licking and grooming, and arched back nursing (high LG–ABN), which, similarly to handled pups, receive increased maternal care, had increased NR2B, but also NR1 and NR2A mRNA levels in the hippocampus (Liu et al., 2000; Bredy et al., 2004). It should be pointed out however, that in the studies by Liu et al. (2000) and Bredy et al. (2004) the comparison was performed between offspring of high and low LG–ABN mothers, i.e. animals exposed to maternal behavior ranking at either end of the scale: either one standard deviation above or below the population mean. This type of comparison can reveal even subtle differences, which do not emerge when the comparison is between means of unselected samples, as in our study. Our results demonstrated an upregulation of NR2B binding and mRNA in the amygdaloid nuclei of female handled rats, which was statistically significant in the central and medial nuclei. The amygdala has long been implicated in the processing of emotionally charged stimuli, particularly fear (for reviews see: Rasia-Filho et al., 2000; Fanselow and Gale, 2003). Although much evidence has implicated the lateral nucleus as an essential locus of learning, memory and extinction of fear, recent findings have indicated that the central nucleus of the amygdala is not only involved in fear expression but also in all stages of

fear-related stimuli processing (Wilensky et al., 2006). Several behavioral and pharmacological studies suggest the participation of NMDA receptors of the amygdala in the different stages of fear conditioning, in the underlying mechanisms of which the NR2B subunit appears to have a unique role (Walker and Davis, 2008). Although many of the behavioral studies using NR2B antagonists focused on the lateral nuclei, recent studies suggest that another site of NR2B antagonist action could be the central nucleus. These studies have shown that the ratio of NR2B to NR2A is greater in central than in lateral amygdala and that ifenprodil blocks NMDA responses more in the central than the lateral amygdala (Lopez de Armentia and Sah, 2003). Neonatal handling has been shown to decrease emotional responses in adulthood, as assessed by behavioral paradigms measuring innate fear, such as exploratory behaviour in novel environments (Fernández-Teruel et al., 1991; Ferre et al., 1995; Vallee et al., 1997; Madruga et al., 2006; Benetti et al., 2007). On the other hand, reports on the effects of neonatal handling on learned fear appear to be contradictory: some show that handling impairs twoway active avoidance learning (Kosten et al., 2007), while others show enhancement (Escorihuela et al., 1994; Pryce et al., 2003); fear conditioning for context and tone has been reported to be either unaffected by handling (Pryce et al., 2003), or impaired (Meerlo et al., 1999; Kosten et al., 2006; Madruga et al., 2006), while there is one report that among young rats (45 days old) the handled showed more freezing behavior than the non-handled in a contextual fear

1464

A. Stamatakis et al. / Neuroscience 164 (2009) 1457–1467

Table 4. NR2B binding site levels in the brain of adult rats Male non-handled

Male handled

Female non-handled

Female handled

Handling effect

Sex effect

Handling X sex interaction

CA1-d

555⫾16

614⫾32

566⫾25

627⫾20

CA3-d

589⫾14

627⫾36

596⫾50

627⫾9

F1,19⫽4.671 P⫽0.048 F1,19⫽5.080 P⫽0.041

F1,19⫽0.013 P⫽0.910 F1,19⫽0.087 P⫽0.773

F1,19⫽0.179 P⫽0.679 F1,19⫽0.057 P⫽0.814

DG-d CA1-v CA3-v DG-v CeA

604⫾20 667⫾20 639⫾51 672⫾64 550⫾27

615⫾25 675⫾15 648⫾69 676⫾51 555⫾20

600⫾43 680⫾19 637⫾67 647⫾77 472⫾56

605⫾9 664⫾20 654⫾56 659⫾32 614⫾40

MeA

485⫾32

490⫾20

440⫾41

548⫾23

BLA PL

561⫾76 504⫾26

542⫾43 555⫾17

577⫾60 463⫾24

586⫾71 532⫾38

IL AC

474⫾21 510⫾20

501⫾11 602⫾31

466⫾22 485⫾36

461⫾19 544⫾29

Pir Sm-out

627⫾9 559⫾9

616⫾36 622⫾36

605⫾41 553⫾25

622⫾25 604⫾7

Sm-in

521⫾31

611⫾32

530⫾41

593⫾18

Occ-out Occ-in

596⫾17 548⫾15

592⫾27 558⫾31

592⫾21 560⫾31

595⫾19 562⫾12

F1,19⫽4.644 P⫽0.049 F1,19⫽5.163 P⫽0.041 F1,19⫽6.411 P⫽0.024

F1,19⫽1.845 P⫽0.196

F1,19⫽0.139 P⫽0.715

F1,19⫽7.368 P⫽0.018

F1,19⫽2.205 P⫽0.161

F1,19⫽0.291 P⫽0.599

F1,19⫽5.623 P⫽0.033 F1,19⫽7.801 P⫽0.014

F1,19⫽0.825 P⫽0.379 F1,19⫽0.032 P⫽0.860

F1,19⫽0.001 P⫽0.970 F1,19⫽0.222 P⫽0.645

Mean⫾SEM of Average fmoles/milligram tissue of non-handled and handled male and female animals.

conditioning paradigm (Beane et al., 2002). It should be mentioned that most of these studies have been performed using male rats, while it is well documented that the effects of neonatal handling are quite often sexually dimorphic (Smythe et al., 1994; Papaioannou et al., 2002a,b; Park et al., 2003; Stamatakis et al., 2006, 2008). In general, female rats are known to exhibit higher levels of emotionality, increased inhibitory avoidance, greater unconditioned fear and enhanced responses to aversive stimuli than males (Kosten et al., 2005, 2007). Interestingly, handled females show increased extinction of fear (Stevenson et al., 2009), a process in which NMDA receptors in the amygdala are known to be involved (for a review see: Walker and Davis, 2002). Our results showing a handling-induced increase in NR2B levels only in the amygdala of females could be related to the enhancement of fear extinction exhibited by handled females (Stevenson et al., 2009). Our results also revealed a handling-induced increase in the NR2B NMDA receptor subunit mRNA and binding levels in the prefrontal (PL and AC) and somatosensory cortex, while in the Pir and occipital cortex, although the mRNA was increased, no handling-induced effect was observed on binding levels. An analogous result showing increased NR2B mRNA in the females than the males, while there was no sex difference in the binding levels was found in the somatosensory and occipital cortices. These discrepancies between mRNA and protein levels could emerge as a result of differences in translational or posttranslational processes or in the assembly and insertion of functional NMDA receptors into the membrane. Notably,

similar results showing an effect of an experimental manipulation on NR2B mRNA but not on protein levels have been reported by Rivera-Cervantes et al. (2009). It should be mentioned that the occipital cortex was included in the study as a control brain area in which we did not expect to find a handling-induced effect on NMDA receptor subunit composition. Indeed, handling did not influence the levels of the NR2B functional protein, in spite of the fact that a handling-induced increase in NR2B mRNA was observed. Previous studies have shown that the prefrontal cortex is target area for neonatal handling. More specifically, neonatal handling has been shown to increase GR levels in the prefrontal cortex (Meaney and Aitken 1985, Meaney et al., 1996; Wilber et al., 2009) and to lead to increased function of this brain area (Stevenson et al., 2008). Furthermore, the prefrontal cortex is known to be involved in the stress response, integrating a wide variety of inputs in order to regulate HPA function at an optimal level, a necessary component of good coping ability (Sullivan and Gratton, 2002). Most interestingly, the PL and AC areas of the prefrontal cortex, in which we observed the handlinginduced increase in NR2B levels, have been shown to exert a suppressive effect on the stress-response (Herman et al., 2005; Radley et al., 2006). Thus the increased NR2B levels in the prefrontal cortex could be related to the more efficient HPA axis stress reactivity and increased coping ability, the most well documented characteristic of neonatally handled animals. As mentioned above, no effect of handling was detected on NR1 mRNA levels herein. A recent study by

A. Stamatakis et al. / Neuroscience 164 (2009) 1457–1467

Wilber et al. (2009) reported that a brief neonatal maternal separation protocol, similar to that of handling in our work, resulted in decreased NR1 protein levels in the IL. The discrepancy between our results and those of Wilber et al. could be probably ascribed to the fact that we determined mRNA levels, while Wilber et al. protein levels by immunohistochemistry. It is possible that protein levels are modified without an effect on gene transcription, as illustrated by our own results on the effect of handling on NR2B subunit levels in the dorsal hippocampal CA3. Regarding the somatosensory cortex, previous results have shown that it is activated even after handling the animals only once, for 15 min, on the first day of life (Garoflos et al., 2008). In addition, this same protocol of neonatal handling increased neurotrophin-3 levels in this cortical area (Garoflos et al., 2007). The effects of neonatal handling on the somatosensory cortex could be attributed to the increased tactile stimulation of the pups by their mothers (licking and grooming) upon return to the nest (Levine, 1994; Liu et al., 1997; Pryce et al., 2001; Fenoglio et al., 2006; Garoflos et al., 2008). Furthermore, the neonatal whisker system has been shown to be behaviorally functional and relevant for normal mother–infant interactions, from very early stages after birth (Sullivan et al., 2003). Later in life, including adulthood, the function of the vibrissae, and thus the somatosensory cortex, is intimately involved in exploration and familiarization with new environments (Staiger et al., 2000), behaviours in which neonatally handled animals perform better than the non-handled (Fernández-Teruel et al., 1991; Ferre et al., 1995; Vallee et al., 1997; Madruga et al., 2006; Benetti et al., 2007; Kosten et al., 2007). Notably, partial blocking of NMDA receptors restricts plastic changes in mouse somatosensory barrel cortex (Jablonska et al., 1995, 1999). Furthermore, a recent study on the experience-dependent and -independent synaptic transmission in the barrel cortex indicated that the NMDA receptor current and sensitivity to ifenprodil was strongly affected by deprivation of the whisker input (Mierau et al., 2004). The results presented herein, showing a handling-induced increase in the NR2B NMDA receptor subunit of the somatosensory cortex, are in accordance with previous findings mentioned above, and indicate an increased NR2B-mediated plasticity of the somatosensory cortex in the neonatally handled animals. In the present study we show that the early experience of neonatal handling results in increased NR2B subunitcontaining NMDA receptors in the CA1 and CA3 areas of the dorsal hippocampus, the CeA and MeA, and the PL, AC and somatosensory cortex of the adult rat brain. This effect of handling could be one of the factors underlying the increased plasticity of the brain of neonatally handled animals, which is manifested both at the cellular level, as a more efficient LTP, and at the behavioural/systemic level, as increased adaptability, ability to cope with stress and enhanced cognitive abilities. Acknowledgments—The study was supported by research grants from the Special Account for Research Grants of the University of Athens.

1465

REFERENCES Bajo M, Crawford EF, Roberto M, Madamba SG, Siggins GR (2006) Chronic morphine treatment alters expression of N-methyl-D-aspartate receptor subunits in the extended amygdala. J Neurosci Res 83:532–537. Banneman DM, Rawlins JN, McHugh S, Deacon RM, Yee BK, Best T, Zhang WN, Porthuisen HH, Feldon J (2004) Regional dissociation within the hippocampus—memory and anxiety. Neurosci Biobehav Rev 28:273–283. Beane ML, Cole MA, Spencer RL, Rudy JW (2002) Neonatal handling enhances contextual fear conditioning and alters corticosterone stress responses in young rats. Horm Behav 41:33– 40. Benetti F, Andrade de Araujo P, Sanvitto GL, Lucion AB (2007) Effects of neonatal novelty exposure on sexual behavior, fear, and stressresponse in adult rats. Dev Psychobiol 49:258 –264. Benetti F, Mello PB, Bonini JS, Monteiro S, Cammarota M, Izquierdo I (2009) Early postnatal maternal deprivation in rats induces memory deficits in adult life that can be reversed by donepezil and galantamine. Int J Dev Neurosci 27:59 – 64. Bredy TW, Zhang TY, Grant RJ, Diorio J, Meaney MJ (2004) Peripubertal environmental enrichment reverses the effects of maternal care on hippocampal development and glutamate receptor subunit expression. Eur J Neurosci 20:1355–1362. Champagne FA, Francis DD, Mar A, Meaney MJ (2003) Variations in maternal care in the rat as a mediating influence for the effects of environment on development. Physiol Behav 79:359 –371. Cull-Candy SG, Leszkiewicz DN (2004) Role of distinct NMDA receptor subtypes at central synapses. Sci STKE 2004(255):re16. Czerniawski J, Yoon T, Otto M (2009) Dissociating space and trace in dorsal and ventral hippocampus. Hippocampus 19:20 –32. Deviterne D, Desor D, Krafft B (1990) Maternal behavior variations and adaptations, and pup development within litters of various sizes in Wistar rat. Dev Psychobiol 23:349 –360. Duffy S, Craddock K, Abel T, Nguyen P (2001) Environmental enrichment modifies the PKA-dependence of hippocampal LTP and improves hippocampus-dependent memory. Learn Mem 8:26 –34. Escorihuela RM, Tobeña A, Fernández-Teruel A (1994) Environmental enrichment reverses the detrimental action of early inconsistent stimulation and increases the beneficial effects of postnatal handling on shuttlebox learning in adult rats. Behav Brain Res 61: 169 –173. Fanselow MS, Gale GD (2003) The amygdala, fear, and memory. Ann N Y Acad Sci 985:125–134. Fenoglio KA, Brunson KL, Avishai-Eliner S, Stone BA, Kapadia BJ, Baram TZ (2005) Enduring, handling-evoked enhancement of hippocampal memory function and glucocorticoid receptor expression involves activation of the corticotropin-releasing factor type 1 receptor. Endocrinology 146:4090 – 4096. Fenoglio KA, Chen Y, Baram TZ (2006) Neuroplasticity of the hypothalamic-pituitary-adrenal axis early in life requires recurrent recruitment of stress-regulating brain regions. J Neurosci 26:2434 – 2442. Fernandez-Teruel A, Escorihuela RM, Castellano B, Gonzalez B, Tobena A (1997) Neonatal handling and environmental enrichment effects on emotionality, novelty/reward seeking, and age-related cognitive and hippocampal impairments: focus on the Roman rat lines. Behav Genet 27:513–526. Fernández-Teruel A, Escorihuela RM, Driscoll P, Tobeña A, Bättig K (1991) Infantile (handling) stimulation and behavior in young Roman high- and low-avoidance rats. Physiol Behav 50:563–565. Fernandez-Teruel A, Gimenez-Llort L, Escorihuela RM, Gil L, Aguilar R, Steimer T, Tobena A (2002) Early-life handling stimulation and environmental enrichment. Are some of their effects mediated by similar neural mechanisms? Pharmacol Biochem Behav 73:233– 245. Ferre P, Nunez JF, Garcia E, Tobena A, Escorihuela R, FernandezTeruel A (1995) Postnatal handling reduces anxiety as measured

1466

A. Stamatakis et al. / Neuroscience 164 (2009) 1457–1467

by emotionality rating and hyponeophagia tests in female rats. Pharmacol Biochem Behav 51:199 –203. Flint AC, Maisch US, Weishaupt JH, Kriegstein AR, Monyer H (1997) NR2A subunit expression shortens NMDA receptor synaptic currents in developing neocortex. J Neurosci 17:2469 –2476. Fragioudaki K, Kouvelas ED, Mitsacos A (2003) Differential effect of dopamine deficiency on the expression of NMDA receptor subunits in the weaver mouse brain. Eur J Neurosci 17:2056 –2064. Garner B, Wood SJ, Pantelis C, van den Buuse M (2007) Early maternal deprivation reduces prepulse inhibition and impairs spatial learning ability in adulthood: no further effect of post-pubertal chronic corticosterone treatment. Behav Brain Res 176:323–332. Garoflos E, Stamatakis A, Pondiki S, Apostolou A, Philippidis H, Stylianopoulou F (2007) Cellular mechanisms underlying the effect of a single exposure to neonatal handling on neurotrophin-3 in the brain of 1-day-old rats. Neuroscience 148:349 –358. Garoflos E, Stamatakis A, Rafrogianni A, Pondiki S, Stylianopoulou F (2008) Neonatal handling on the first postnatal day leads to increased maternal behavior and fos levels in the brain of the newborn rat. Dev Psychobiol 50:704 –713. Gruss M, Braun K, Frey JU, Korz V (2008) Maternal separation during a specific postnatal time window prevents reinforcement of hippocampal long-term potentiation in adolescent rats. Neuroscience 152:1–7. Herman JP, Ostrander MM, Mueller NK, Figueiredo H (2005) Limbic system mechanisms of stress regulation: hypothalamo-pituitaryadrenocortical axis. Prog Neuropsychopharmacol Biol Psychiatry 29:1201–1213. Huot RL, Plotsky PM, Lenox RH, McNamara RK (2002) Neonatal maternal separation reduces hippocampal mossy fiber density in adult Long Evans rats. Brain Res 950:52– 63. Jablonska B, Gierdalski M, Kossut M, Skangiel-Kramska J (1999) Partial blocking of NMDA receptors reduces plastic changes induced by short-lasting classical conditioning in the SI barrel cortex of adult mice. Cereb Cortex 9:222–231. Jablonska B, Gierdalski M, Siucinska E, Skangiel-Kramska J, Kossut M (1995) Partial blocking of NMDA receptors restricts plastic changes in adult mouse barrel cortex. Behav Brain Res 66:207– 216. Jaworski JN, Francis DD, Brommer CL, Morgan ET, Kuhar MJ (2005) Effects of early maternal separation on ethanol intake, GABA receptors and metabolizing enzymes in adult rats. Psychopharmacology (Berl) 181:8 –15. Joels M, Pu Z, Wiegert O, Oitzl MS, Krugers HJ (2006) Learning under stress: how does it work? Trends Cogn Sci 10:152–158. Köhr G (2006) NMDA receptor function: subunit composition versus spatial distribution. Cell Tissue Res 326:439 – 446. Kopp C, Longordo F, Luthi A (2007) Experience-dependent changes in NMDA receptor composition at mature synapses. Neuropharmacology 53:1–9. Kosten TA, Lee HJ, Kim JJ (2006) Early life stress impairs fear conditioning in adult male and female rats. Brain Res 1087:142– 150. Kosten TA, Lee HJ, Kim JJ (2007) Neonatal handling alters learning in adult male and female rats in a task-specific manner. Brain Res 1154:144 –153. Kosten TA, Miserendino MJ, Bombace JC, Lee HJ, Kim JJ (2005) Sex-selective effects of neonatal isolation on fear conditioning and foot shock sensitivity. Behav Brain Res 157:235–244. Levine S (1957) Infantile experience and resistance to physiological stress. Science 126:405– 406. Levine S (1994) Maternal behavior as a mediator of pup adrenocortical function. Ann N Y Acad Sci 746:260 –275. Liu D, Diorio J, Day JC, Francis DD, Meaney MJ (2000) Maternal care, hippocampal synaptogenesis and cognitive development in rats. Nat Neurosci 3:799 – 806. Liu D, Diorio J, Tannenbaum B, Caldji C, Francis D, Freedman A, Sharma S, Pearson D, Plotsky PM, Meaney MJ (1997) Maternal

care, hippocampal glucocorticoid receptors, and hypothalamicpituitary-adrenal responses to stress. Science 277:1620 –1621. Lopez de Armentia M, Sah P (2003) Development and subunit composition of synaptic NMDA receptors in the amygdala: NR2B synapses in the adult central amygdale. J Neurosci 23:6876 – 6883. Madruga C, Xavier LL, Achaval M, Sanvitto GL, Lucion AB (2006) Early handling, but not maternal separation, decreases emotional responses in two paradigms of fear without changes in mesolimbic dopamine. Behav Brain Res 166:241–246. Meaney MJ, Aitken DH (1985) The effects of early postnatal handling on hippocampal glucocorticoid receptor concentrations: temporal parameters. Brain Res 354:301–304. Meaney MJ, Aitken DH, Van Berkel C, Bhatnagar S, Sapolsky RM (1988) Effect of neonatal handling on age-related impairments associated with the hippocampus. Science 239:766 –768. Meaney MJ, Diorio J, Francis D, Widdowson J, LaPlante P, Caldji C, Sharma S, Seckl JR, Plotsky PM (1996) Early environmental regulation of forebrain glucocorticoid receptor gene expression: implications for adrenocortical responses to stress. Dev Neurosci 18:49 –72. Meaney MJ, Mitchell JB, Aitken DH, Bhatnagar S, Bodnoff SR, Iny LJ, Sarrieau A (1991) The effects of neonatal handling on the development of the adrenocortical response to stress: implications for neuropathology and cognitive deficits in the later life. Psychoneuroendocrinology 16:85–103. Meerlo P, Horvath KM, Nagy GM, Bohus B, Koolhaas JM (1999) The influence of postnatal handling on adult neuroendocrine and behavioural stress reactivity. J Neuroendocrinol 11:925–933. Mierau S, Meredith RM, Upton AL, Paulsen O (2004) Dissociation of experience-dependent and –independent changes in excitatory synaptic transmission during development of barrel cortex. Proc Natl Acad Sci U S A 101:15518 –15523. Mitchell JB, Iny LJ, Meaney MJ (1990) The role of serotonin in the development and environmental regulation of type II corticosteroid receptor binding in rat hippocampus. Brain Res Dev Brain Res 55:231–235. Monyer H, Burnashev N, Lauric DJ, Sackman B, Seeburg PH (1994) Developmental and regional expression in the rat brain and functional properties of four NMDA receptors. Neuron 12:529 –540. Moser MB, Moser EI (1998) Functional differentiation in the hippocampus. Hippocampus 8:608 – 619. Nakazawa K, McHugh TJ, Wilson MA, Tonegawa S (2004) NMDA receptors, place cells and hippocampal spatial memory. Nat Rev Neurosci 5:361–372. Papaioannou A, Dafni U, Alikaridis F, Bolaris S, Stylianopoulou F (2002a) Effects of neonatal handling on basal and stress-induced monoamine levels in the male and female rat brain. Neuroscience 114:195–206. Papaioannou A, Gerozissis K, Prokopiou A, Bolaris S, Stylianopoulou F (2002b) Sex differences in the effects of neonatal handling on the animal’s response to stress and the vulnerability to depressive behaviour. Behav Brain Res 129:131–139. Park MK, Hoang TA, Belluzzi JD, Leslie FM (2003) Gender specific effect of neonatal handling on stress reactivity of adolescent rats. J Neuroendocrinol 15:289 –295. Paxinos G, Watson C (2007) The rat brain in stereotaxic coordinates, 6th ed. San Diego, CA: Academic Press. Pham TM, Söderström S, Henriksson BG, Mohammed AH (1997) Effects of neonatal stimulation on later cognitive function and hippocampal nerve growth factor. Behav Brain Res 86:113–120. Philpot BD, Sekhar AK, Shouval HZ, Bear MF (2001) Visual experience and deprivation bidirectionally modify the composition and function of NMDA receptors in visual cortex. Neuron 29:157–169. Pickering C, Gustafsson L, Cebere A, Nylander I, Liljequist S (2006) Repeated maternal separation of male Wistar rats alters glutamate receptor expression in the hippocampus but not the prefrontal cortex. Brain Res 1099:101–108.

A. Stamatakis et al. / Neuroscience 164 (2009) 1457–1467 Pryce CR, Bettschen D, Feldon J (2001) Comparison of the effects of early handling and early deprivation on maternal care in the rat. Dev Psychobiol 38:239 –251. Pryce CR, Bettschen D, Nanz-Bahr NI, Feldon J (2003) Comparison of the effects of early handling and early deprivation on conditioned stimulus, context, and spatial learning and memory in adult rats. Behav Neurosci 117:883– 893. Radley JJ, Arias CM, Sawchenko PE (2006) Regional differentiation of the medial prefrontal cortex in regulating adaptive responses to acute emotional stress. J Neurosci 26:12967–12976. Rao VR, Finkbeiner S (2007) NMDA and AMPA receptors: old channels, new tricks. Trends Neurosci 30:284 –291. Rasia-Filho AA, Londero RG, Achaval M (2000) Functional activities of the amygdala: an overview. J Psychiatry Neurosci 25:14 –23. Rivera-Cervantes MC, Flores-Soto ME, Chaparro-Huerta V, ReyesGómez J, Feria-Velasco A, Schliebs R, Beas-Zárate C (2009) Changes in hippocampal NMDA-R subunit composition induced by exposure of neonatal rats to L-glutamate. Int J Dev Neurosci 27:197–204. Roceri M, Hendriks W, Racagni G, Ellenbroek BA, Riva MA (2002) Early maternal deprivation reduces the expression of BDNF and NMDA receptor subunits in rat hippocampus. Mol Psychiatry 7:609 – 616. Smythe JW, McCormick CM, Rochford J, Meaney MJ (1994) The interaction between prenatal stress and neonatal handling on nociceptive response latencies in male and female rats. Physiol Behav 55:971–974. Staiger JF, Bisler S, Schleicher A, Gass P, Stehle JH, Zilles K (2000) Exploration of a novel environment leads to the expression of inducible transcription factors in barrel-related columns. Neuroscience 99:7–16. Stamatakis A, Mantelas A, Papaioannou A, Pondiki S, Fameli M, Stylianopoulou F (2006) Effect of neonatal handling on serotonin 1A sub-type receptors in the rat hippocampus. Neuroscience 140:1–11. Stamatakis A, Pondiki S, Kitraki E, Diamantopoulou A, Panagiotaropoulos T, Raftogianni A, Stylianopoulou F (2008) Effect of neonatal handling on adult rat spatial learning and memory following acute stress. Stress 11:148 –159. Stevenson CW, Marsden CA, Mason R (2008) Early life stress causes FG-7142-induced corticolimbic dysfunction in adulthood. Brain Res 1193:43–50.

1467

Stevenson CW, Meredith JP, Spicer CH, Mason R, Marsden CA (2009) Early life programming of innate fear and fear learning in adult female rats. Behav Brain Res 198:51–57. Sullivan RM, Gratton A (2002) Prefrontal cortical regulation of hypothalamic-pituitary-adrenal function in the rat and implications for psychopathology: side matters. Psychoneuroendocrinology 27: 99 –114. Sullivan RM, Landers MS, Flemming J, Vaught C, Young TA, Jonathan Polan H (2003) Characterizing the functional significance of the neonatal rat vibrissae prior to the onset of whisking. Somatosens Mot Res 20:157–162. Tang AC, Zou B (2002) Neonatal exposure to novelty enhances longterm potentiation in CA1 of the rat hippocampus. Hippocampus 12:398 – 404. Tang YP, Wang H, Feng R, Kyin M, Tsien JZ (2001) Differential effects of enrichment on learning and memory function in NR2B transgenic mice. Neuropharmacology 41:779 –790. Vallee M, Mayo W, Dellu F, Le Moal M, Simon H, Maccari S (1997) Prenatal stress induces high anxiety and postnatal handling induces low anxiety in adult offspring: correlation with stress-induced corticosterone secretion. J Neurosci 17:2626 –2636. van Praag H, Christie B, Sejnowski T, Gage F (1999) Running enhances neurogenesis, learning, and long-term potentiation in mice. Proc Natl Acad Sci U S A 96:13427–13431. Walker DL, Davis M (2002) The role of amygdala glutamate receptors in fear learning, fear-potentiated startle, and extinction. Pharmacol Biochem Behav 71:379 –392. Walker DL, Davis M (2008) Amygdala infusions of an NR2B or an NR2A–preferring NMDA receptor antagonist differentially influence fear conditioning and expression in the fear-potentiated startle test. Learn Mem 15:67–74. Wilber AA, Southwood CJ, Wellman CL (2009) Brief neonatal maternal separation alters extinction of conditioned fear and corticolimbic glucocorticoid and NMDA receptor expression in adult rats. Dev Neurobiol 69:73– 87. Wilensky AA, Schafe GE, Krstensen MP, LeDoux JE (2006) Rethinking the fear circuit: the central nucleus of the amygdala is required for the acquisition, consolidation, and expression of Pavlovian fear conditioning. J Neurosci 26:12387–12396. Wong R, Jamieson JL (1968) Infantile handling and the facilitation of discrimination and reversal learning. Q J Exp Psychol 20:197–199. Yashiro K, Philpot BD (2008) Regulation of NMDAreceptor subunit expression and its implications for LTD, LTP, and metaplasticity. Neuropharmacology 55:1081–1094.

(Accepted 15 September 2009) (Available online 22 September 2009)