1-alpha,25-Dihydroxyvitamin D3 up-regulates the expression of 2 types of human intestinal alkaline phosphatase alternative splicing variants in Caco-2 cells and may be an important regulator of their expression in gut homeostasis

1-alpha,25-Dihydroxyvitamin D3 up-regulates the expression of 2 types of human intestinal alkaline phosphatase alternative splicing variants in Caco-2 cells and may be an important regulator of their expression in gut homeostasis

    1-alpha, 25-dihydroxyvitamin D 3 up-regulates the expression of two types of human intestinal alkaline phosphatase alternative splici...

1MB Sizes 0 Downloads 15 Views

    1-alpha, 25-dihydroxyvitamin D 3 up-regulates the expression of two types of human intestinal alkaline phosphatase alternative splicing variants in Caco-2 cells and may be an important regulator of their expression in gut homeostasis Seiko Noda, Asako Yamada, Kanae Nakaoka, Masae Goseki-Sone PII: DOI: Reference:

S0271-5317(17)30091-X doi: 10.1016/j.nutres.2017.07.005 NTR 7781

To appear in:

Nutrition Research

Received date: Revised date: Accepted date:

28 January 2017 19 May 2017 18 July 2017

Please cite this article as: Noda Seiko, Yamada Asako, Nakaoka Kanae, Goseki-Sone Masae, 1-alpha, 25-dihydroxyvitamin D3 up-regulates the expression of two types of human intestinal alkaline phosphatase alternative splicing variants in Caco-2 cells and may be an important regulator of their expression in gut homeostasis, Nutrition Research (2017), doi: 10.1016/j.nutres.2017.07.005

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

IP T

Nutrition Research

1-a l ph a, 2 5- di h ydro xyvi ta mi n D 3 up -re gu l ates t h e

SC R

e xpr essi on of t wo t yp es of h u ma n i ntest in al a lka li ne ph osph atase alt ern at i ve sp l ici n g var ia nts in Ca co -2 cel ls a nd ma y b e a n i mp or ta nt r eg ul ato r of t he ir

NU

e xpr essi on in g ut h omeos tas is

MA

S e i k o N o d a , A s a k o Ya m a d a , K a n a e N a k a o k a ,

ED

Masae Goseki-Sone*

Department of Food and Nutri tion, Faculty of Human Sciences

CE

PT

a n d D e s i g n , J a p a n W o me n ’s U n i v e r s i t y, To k y o , J a p a n

* C o r r e s p o n d i n g a u t h o r.

AC

Masae Goseki-Sone, Ph. D. Department of Food and Nutriti on, Faculty of Human Sciences

a n d D e s i g n , J a p a n W o m e n ’s U n i v e r s i t y, 2 - 8 - 1 , M e j i r o d a i , B u n k y o - k u , To k y o 11 2 - 8 6 8 1 , J a p a n . Te l & F a x : + 8 1 - 3 - 5 9 8 1 - 3 4 2 9 E-mail address: [email protected] (M. Goseki -Sone)

1

ACCEPTED MANUSCRIPT

Abbreviations: alkaline phosphatase; ALP, intestinal ALP; IAP,

IP T

1-alpha, 25-dihydroxyvitamin D3; 1, 25(OH)2D3,

AC

CE

PT

ED

MA

NU

SC R

sucrase-isomaltase; SI, vitamin D receptor; VDR.

2

ACCEPTED MANUSCRIPT

IP T

ABSTRACT

Vitamin D insufficiency is associated with a greater risk of

SC R

osteoporosis and also influences skeletal muscle functions, differentiation, and development.

The principal function of

vitamin D in calcium homeostasis is to increase the absorption

NU

of calcium from the intestine , and the level of alkaline phosphatase (ALP) activity, a differentiation marker for

D.

MA

intestinal epithelial cells, is reg ulated by vitamin Intestinal-type ALP is expressed at a high concentration in

ED

the brush border membrane of intestinal epithelial cells , and is

PT

known to be affected by several kinds of nutrient s.

Recent

r e v i e w s h a v e h i g h l i g h t e d t h e i m p o r t a n c e o f i n t e s t i n a l - t yp e A L P Intestinal -type ALP controls bacterial

CE

in gut homeostasis.

endotoxin-induced inflammation by dephosphorylating

AC

l i p o p o l y s a c c h a r i d e a n d i s a g u t m u c o s a l d e f e n s e f a c t o r. I n t h i s s t u d y, w e i n v e s t i g a t e d t h e i n f l u e n c e o f v i t a m i n D o n t h e e xp r e s s i o n o f t w o t yp e s o f a l t e r n a t i v e m R N A v a r i a n t s e n c o d i n g the human alkaline phosphatase, intestinal (ALPI) gene in human Caco-2 cells as an in vitro model of the small intestinal epithelium.

After treatment with 1-alpha, 25 -dihydroxyvitamin

D3, the biologically active form of vitamin D 3, there were significant increases in the ALP activities of Caco -2 cells. I n h i b i t o r a n d t h e r m a l i n a c t i va t i o n e x p e r i m e n t s s h o w e d t h a t t h e

3

ACCEPTED MANUSCRIPT

i n c r e a s e d A L P h a d p r o p e r t i e s o f i n t e s t i n a l - t y p e A L P.

Reverse

IP T

transcription-polymerase chain reaction analysis revealed that e xp r e s s i o n o f t h e t wo t y p e s o f a l t e r n a t i v e m R N A v a r i a n t s f r o m

cells.

SC R

the ALPI gene was markedly enhanced by vitamin D in Caco -2 I n c o n c l u s i o n , t h e s e f i n d i n g s a g r e e w i t h t h e h yp o t h e s i s :

vitamin D up-regulated the expression of two types of human

NU

intestinal alkaline phosphatase alternative splicing variants in

MA

Caco-2 cells; vitamin D may be an important regulator of ALPI g e n e e xp r e s s i o n i n g u t h o m e o s t a s i s .

ED

K e y w o r d s : v i t a m i n D ; 1 - a l p h a , 2 5 - d i h yd r o x y v i t a m i n D 3 ; i n t e s t i n a l a l k a l i n e p h o s p h a t a s e ; a l t e r n a t i ve m R N A v a r i a n t s ;

AC

CE

PT

Caco-2 cells.

4

ACCEPTED MANUSCRIPT

1. Introduction

IP T

Alkaline phosphatase (ALP : orthophosphoric monoester phospho-hydrolase, alkaline optimum, EC 3.1.3.1.) is

SC R

distributed widely throughout the living world from bacteria to a n i m a l s , a n d i t e x i s t s i n va r i o u s t i s s u e s s u c h a s t h e b o n e , l i v e r, k i d n e y, i n t e s t i n e , a n d p l a c e n t a .

ALP is an enzyme containing

NU

zinc which hydrolyzes monophosphate esters into inorganic

MA

phosphoric acid and alcohol at a high optimal pH (pH 8 -10). In humans, there are primarily four different types of this enzyme: tissue-nonspecific ALP (liver/bone/kidney: TNSALP),

ALP [1-4].

ED

intestinal-type ALP (IAP), placental-type ALP, and germ cell Based on studies on cDNA encoding ALP

PT

isozymes, the primary structure in the catalytic region was demonstrated to be well-conserved in the ALPs of humans,

CE

animals, and Escherichia coli, suggesting that both IAP and

AC

TNSALP play important roles in active metabolism by h yd r o l y z i n g p h o s p h o - c o m p o u n d s [ 1 ] . I A P i s e xp r e s s e d a t a h i g h c o n c e n t r a t i o n i n t h e b r u s h

border membrane of intestinal epithelial cells .

IAP

e xp r e s s i o n i s l o s t w i t h s t a r va t i o n , b u t r e f e e d i n g s t i m u l a t e s I A P e xp r e s s i o n i n m i c e [ 5 ] .

Recently, it was suggested that IAP

may affect not only phosphate metabol ism but also lipid metabolism based on an experiment using intestinal ALP knockout mice [6, 7].

On long-term feeding of a high -fat diet,

IAP knockout mice exhibited faster body weight gain than wild-type mice [8].

However, in the IAP knockout mice , even

those on a low-fat diet, glucose intolerance and the 5

ACCEPTED MANUSCRIPT

accumulation of visceral fat were observed, demonstrati ng Furthermore, the

IP T

c h a r a c t e r i s t i c s o f m e t a b o l i c s yn d r o m e [ 9 ] . gram-negative bacterial cell wall component

lipopolysaccharide (LPS) is known as an endotoxin ; as IAP has

SC R

the ability to detoxify LPS, IAP is a gut mucosal defense factor [5].

Vitamin D is important for developing strong, healthy bones

NU

in children and helping to protect against osteoporosis, bone fractures, and breaks in older adults.

Dietary vit amin D

MA

absorbed from the gastrointestinal tract and vitamin D s yn t h e s i z e d i n t h e e p i d e r m i s i n r e s p o n s e t o u l t r a v i o l e t

ED

r a d i a t i o n u n d e r g o c o n v e r s i o n t o 2 5 - h yd r o x y v i t a m i n D 3 i n t h e l i v e r , w i t h t h e s u b s e q u e n t c o n v e r s i o n o f 2 5 - h yd r o x y v i t a m i n D 3

PT

to 1-alpha, 25-dihydroxyvitamin D3 [1, 25(OH)2D3] via complex metabolic pathways in the kidney.

Vitamin D regulates bone

CE

metabolism and is known to play an essential role in enhancement of the absorption of calcium and phosphate from

AC

the intestine.

In addition, vitamin D modulates muscle and

bone-derived hormones, facilitating c ross-talk between these tissues, and reduced levels of vitamin D are associated with m e t a b o l i c s yn d r o m e [ 8 ] , e p i t h e l i a l b a r r i e r d y s f u n c t i o n , a n d intestinal inflammation [9]. Previously, we reported that vitamin D restriction markedly decreased the levels of intestinal ALP activity using a rat model [10], and these findings indicate the possibility that the restriction of vitamin D influences gut homeostasis via decreasing the level of ALP activity.

Although most species

e xp r e s s a s i n g l e I A P , s e v e r a l k i n d s o f I A P h a v e b e e n i d e n t i f i e d 6

ACCEPTED MANUSCRIPT

in three species: the mouse [11], rat [12, 13], and cow [14].

IP T

In rats, two different cDNA clone s, IAP-I and IAP-II, for rat intestinal ALP were isolated by Lowe et al. [12] and Strom et al. [13], respectively.

The two isozymes are products of two

a t t h e a m i n o a c i d l e ve l .

SC R

distinct genes and their cDNA sequences show 79% homology Functional differences between IAP -I

and IAP-II were suggested by different regulation s of the

NU

e xp r e s s i o n o f t h e t w o m R N A s [ 1 5 ] , a s w e l l a s b y s t r u c t u r a l a n d catalytic differences [16].

MA

In humans, a single gene for human IAP has been isolated, and the multiple forms of mRNAs encoding human IAP are due The human alkaline

ED

to differences in polyadenylation [2].

phosphatase, intestinal (ALPI) gene (NCBI, GenBank

PT

Accession No.J03930) is located on chromosome 2 [2], and it contains 10 distinct introns .

It was reported that transcription

CE

p r o d u c e s 2 a l t e r n a t i v e l y s p l i c e d m R N A s [ va r i a n t a A u g 1 0 (NM_001631) and variant bAug10 (M31008)] (NCBI, AceView)

AC

from the human ALPI gene [17].

The main variant aAug10 is

2 , 5 5 0 b p l o n g , a n d va r i a n t b A u g 1 0 i s 1 , 8 8 4 b p l o n g .

The two

spliced mRNAs putatively encode proteins (528 and 438 amino acids), comprising 2 different isoforms, containing the ALP domain and some transmembrane domains.

However, there

has been no report on the regulation of the expression of these alternative mRNA variants by vitamin D. The human colon carcinoma cell line Caco -2 grown in vitro under standard culture conditions in the absence of inducers of differentiation spontaneously exhibits enterocyte -like differentiation and polarization [18]. 7

As human primary

ACCEPTED MANUSCRIPT

enterocytes cannot be obtained in large numbers, Caco -2 cell

model of the human small intestine.

IP T

m o n o l a y e r s a r e w i d e l y u t i l i ze d f o r d r u g a b s o r p t i o n s t u d i e s a s a In Caco-2 cells,

d i f f e r e n t i a t i o n i s c h a r a c t e r i ze d b y h i g h a c t i v i t y l e v e l s o f b r u s h

SC R

border-associated enzyme s such as ALP [18].

However,

there has been no report about the regulation of the e xp r e s s i o n o f t h e s e a l t e r n a t i v e m R N A v a r i a n t s f r o m t h e h u m a n

NU

ALPI gene in the differentiation of C aco-2 cells. Considering the essential role of intestinal-type ALP in gut

MA

homeostasis and health, we hypothesized that vitamin D u p - r e g u l a t e s t h e e x p r e s s i o n o f m R N A va r i a n t s f r o m t h e h u m a n W e designed two sets of specific polymerase

ED

ALPI gene.

c h a i n r e a c t i o n ( P C R ) p r i m e r s f o r t w o t yp e s o f h u m a n i n t e s t i n a l

PT

A L P a l t e r n a t i ve s p l i c i n g v a r i a n t s a n d c o m p a r e d t h e i r

Methods and materials

AC

2.

CE

e xp r e s s i o n p r o f i l e s i n C a c o - 2 c e l l s t r e a t e d w i t h v i t a m i n D .

2.1. Cell culture Caco-2 cells (RIKEN Cell Bank; RCB0988, Ibaraki, Japan ) w e r e g r o w n a t 3 7 ℃ i n 5 % C O 2 i n D u l b e c c o ’s m o d i f i e d E a g l e ’s m e d i u m ( D M E M ) ( G i b c o , B R L , G r a n d I s l a n d , N Y, U S A ) containing 10% fetal bovine serum (FBS) (Gibco, BRL, Grand I s l a n d , N Y, U S A ) , 1 % n o n - e s s e n t i a l a m i n o a c i d s ( N E A A ) , a n d a n t i b i o t i c s ( 1 0 0 u n i t s / m L p e n i c i l l i n , 5 0 μ g / m L s t r e p t o m yc i n , a n d 1 0 0 μ g / m L o f n e o m y c i n ) ( G i b c o , B R L , G r a n d I s l a n d , N Y, 8

ACCEPTED MANUSCRIPT

USA).

IP T

Vi t a m i n D [ 1 , 2 5 ( O H ) 2 D 3 ] ( M e r c k L i f e S c i e n c e , D a r m s t a d t , Germany) was dissolved in ethanol and stored at -80℃ in the

SC R

dark until use.

Caco-2 cells were plated at a density of 1×104 cells/cm2 o n t o a 3 5 - m m d i s h ( FA L C O N , B e d f o r d , U S A ) .

The cells were

NU

i n c u b a t e d f o r 2 d a y s u n t i l 6 0 ~ 7 0 % c o n f l u e n c y, a n d d e s i r e d

MA

concentrations of 1, 25(OH)2D3 (0, 1.0, 10.0, and 100.0 nM) were added.

The final concentrat ion of the vehicle was 0.1%

ED

of the culture medium, and the culture medium was changed twice a week.

Cells were assayed on days 0, 1, 3, 5, and 7

PT

after the addition of 1, 25(OH)2D3.

CE

2.2. Enzyme preparation and assay

AC

Each sample was homogenized using a Polytron homogenizer (Kinematica, Swit zerland) with 10 mM Tr i s - b u f f e r e d s a l i n e ( T B S ) c o n t a i n i n g 1 % Tr i t o n X - 1 0 0 ( p H 7 . 3 ) and 1 mM phenylmethylsulfonyl fluoride (PMSF).

After

centrifugation at 7,000 ×g for 5 min, the supernatant was used as the enzyme extract.

ALP activity was determined with 10

mM p-nitro-phenylphosphate as a substrate in 100 mM 2-amino-2-methyl-1,3-propandiole HCl buffer contai ning 5 mM MgCl2, pH 10.0, at 37 ℃ , as previously reported [19].

The

enzyme activity was also assayed in the presence of the 9

ACCEPTED MANUSCRIPT

inhibitor levamisole (Lev) and L-phenylalanine (L-Phe).

For

IP T

t h e r m o s t a b i l i t y, t h e e n z y m e p r e p a r a t i o n w a s p r e h e a t e d a t 5 6 ℃ for 10 min and then reacted with the subs trate [20].

The

SC R

enzyme activity was determined as the rate of hydrolysis of p-nitro-phenylphosphate and expressed in units (U= μmol p-nitro-phenol formed/min).

NU

Protein concentrations were determined using

MA

bicinchoninic acid (BCA) protein assay reagent ( Pierce,

ED

Rockford, IL, USA) [21].

2.3. Enzyme histochemistry

day 7.

PT

C a c o - 2 c e l l s o n c o ve r s l i p s w e r e s t a i n e d f o r A L P a c t i v i t y o n C e l l s w e r e f i x e d w i t h 1 0 % f o r m a l i n (W a k o , O s a k a ,

CE

Japan) for 10 min on ice and washed three times with 0.1 M The cells were incubated with a mixture of 0.1 mg/mL of

AC

TBS.

n a p h t h o l A S - M X p h o s p h a t e ( S i g m a - A l d r i c h , St e i n h e i m , G e r m a n y ) a n d 0 . 4 M Tr i s - H C l b u f f e r c o n t a i n i n g 5 m M M g C l 2 a t room temperature for 30 min.

Then, cells were

counterstained with Fast red violet salt ( Sigma-Aldrich, St e i n h e i m , G e r m a n y ) [ 2 2 ] .

2.4. Reverse transcription -polymerase chain reaction (RT-PCR) analyses Total RNA from the cells was extracted by the 10

ACCEPTED MANUSCRIPT

thiocyanate-phenol-chloroform extraction method (CS104 Human adult small

IP T

RNAzolTMB,Tel-Test, Inc., TX, USA) [23].

i n t e s t i n e t o t a l R N A wa s p u r c h a s e d f r o m C l o n t e c h L a b o r a t o r i e s ,

SC R

Inc. (Palo Alto, CA, USA).

As a template for PCR, single -strand cDNA was prepared from 2 μg of total RNA using PrimeScript 1st strand cDNA

NU

s yn t h e s i s k i t ( T a k a r a , S h i g a , J a p a n ) .

PCR primers were used

MA

for human IAP (hIAP) [24] and the human vitamin D receptor (hVDR) [25].

W e designed two sets of specific PCR primers: hIAP-a for

ED

the variant aAug10 (forward:5’-

PT

GCAACCCTGCAACCCACCCAAGGAG -3’, reverse: 5’-CCAGCATCCAGATGTCCCGGGAG-3’), and hIAP-b for the

CE

variant bAug10 (forward: 5’- GCTGACCTGATCTCTACTCT -3’,

AC

reverse: 5’-ACCTCATTGCCGCGTGTCGT -3’). Amplification was performed with Taq DNA polymerase

(Takara, Shiga, Japan) by 2-step incubation using SimpliAmp TM Thermal Cycler (Thermo Fisher Scientific, M A, USA) at 94℃ (1 min), 50℃ (1 min), and 72℃ (1 min) for 5 cycles and at 94 ℃ (0.5 min), 50℃ (0.5 min), and 72℃ (0.5 min) for 25 cycles. The amplified samples were analyzed using 5.25% polyacrylamide gel electrophoresis (PAGE). were observed with UV l ight.

The stained gels

The density of the photograph

was determined using Image Analysis Software (CS Analyzer 3 11

ACCEPTED MANUSCRIPT

for W indows, ATTO, Tokyo, Japan).

A l l va l u e s w e r e

IP T

normalized to the housekeeping gene

SC R

glyceraldehyde -3-phosphate dehydrogenase (GAPDH) .

2.5. DNA sequencing

The nucleotide sequences of PCR products (hIAP-a for the

NU

variant aAug10 , and hIAP-b for the variant bAug10) from

MA

human adult small intestine total RNA were verified by direct sequencing using the BigDyeR Terminator v.3.1 Cycle

ED

Sequencing Kit (Applied Biosys tems, CA, USA) with a 3730xl

PT

DNA Analyzer (Applied Biosystems, CA, USA) [26].

2.6. Statistical analyses

CE

Va l u e s a r e s h o w n a s t h e m e a n s ± s t a n d a r d e r r o r ( S . E . ) D u n n e t t ’s m u l t i p l e

AC

(n=3) from triplicate experiments .

c o m p a r i s o n t e s t w a s u s e d a f t e r A N O VA t o c o m p a r e t h e significance of differences of the ALP activities and protein concentrations among 1, 25(OH)2D3 concentrations of 0, 1, 10, and 100 nM.

T h e u n p a i r e d t w o - t a i l e d St u d e n t ’s t - t e s t wa s

used to compare the significance of differences between 1, 25(OH)2D3 concentrations of 0 and 100 nM in the inhibition and thermal inactivation experiments .

Comparisons of the

relative expression levels of mRNA between the 1, 25(OH)2D3-treated group (100 nM) and control group (0 nM) in 12

ACCEPTED MANUSCRIPT

t h e RT- P C R a n a l y s e s w e r e p e r f o r m e d u s i n g t h e u n p a i r e d

significant at p<0.05.

Differences were considered

IP T

t wo - t a i l e d St u d e n t ’s t - t e s t .

Analysis was conducted using IBM

SC R

S P S S St a t i s t i c s ( v e r s i o n 2 2 , I B M C o r p o r a t i o n , S o m e r s , N Y, USA).

NU

R e s u l ts

3.1. ALP activity

MA

3.

ED

Caco-2 cells were cult ured in several concentrations of 1, 25(OH)2D3 (0, 1, 10, and 100 nM) in the medium.

As shown in

PT

Fig. 1, the levels of ALP activity of the enzyme preparations of Caco-2 cells were gradually increased until day 5, and were

CE

maintained on day 7.

On days 5 and 7, the ALP activities of

AC

the 1, 25(OH)2D3-treated groups (1 n M) were significantly higher compared with the control group (0 n M) (p<0.01 and

p<0.001, respectively) .

Furthermore, the level of ALP activity

of the 1, 25(OH)2D3-treated groups (10 n M) was significantly higher compared with the control group (0 n M) on days 3, 5, and 7 (p<0.01, p<0.001, and p<0.001, respectively).

M o r e o ve r , t h e

level of ALP activity of the 1, 25(OH)2D3-treated groups (100 nM) was markedly higher compared with the control grou p (0 nM) on days 3, 5, and 7 (p<0.001, p<0.001, and p<0.001, respectively).

Vitamin D enhanced ALP activity in a 13

ACCEPTED MANUSCRIPT

dose-dependent manner after day 3, and the level of ALP

IP T

activity of the 1, 25(OH)2D3-treated group (100 nM) was increased about 3-fold compared with the control group (0 n M) There were no significant difference s in the protein

SC R

on day 5.

concentrations (mg/mL) of these enzyme preparations between the 1, 25(OH)2D3-treated group (1, 10, or 100 nM) and control

MA

NU

group (0 nM) (data not shown).

3.2. Enzyme histochemistry

ED

Cell morphology during 1, 25(OH)2D3 treatment was observed with light microscopy.

On days 5~6, Caco-2 cells

PT

grew to confluency and exhibite d monolayers in the plastic culture wells.

As shown in Fig. 2 (B), (C), and (D), the ALP

CE

enzyme-staining-positive Caco-2 cells (stained red) were

AC

clearly noted in all of the 1, 25(OH)2D3-treated groups (1, 10, and 100 nM) on day 7.

3.3. Properties of ALP of Caco -2 cells T h e r e s u l t s o f t h e i n h i b i t i o n a n d t h e r m a l i n a c t i va t i o n e xp e r i m e n t s i n t h e e n z y m e p r e p a r a t i o n s o f C a c o - 2 c e l l s o n d a y 7 are shown in Table 1.

Remaining ALP activity following the

treatments is expressed as a percenta ge of the untreated control.

The enzyme preparations of Caco -2 cells were

effectively inhibited by L -phenylalanine but not by levamisole, 14

ACCEPTED MANUSCRIPT

and were heat-stable (56℃ , 10 min), corresponding to the There

IP T

p r o p e r t y o f o t h e r m a m m a l i a n i n t e s t i n a l - t yp e A L P s [ 2 7 ] .

were no significant difference s in the remaining ALP activit ies

SC R

between the 1, 25(OH)2D3-treated group (100 nM) and control group (0 nM) (Table 1).

NU

3.4. Detection and sequence of human IAP splicing variants

MA

In order to verify the two types of alternative splicing mRNA variants (variants aAug10 and bAug10) from the human ALPI gene, we performed RT-PCR analysis using their specific

ED

primers [hIAP-a (2,101-2,376) and hIAP-b (118-524)].

The

genomic organization and structure of alternatively spl iced

PT

transcripts of human IAP are demonstrated in Fig. 3.

The

v a r i a n t a A u g 1 0 h a s 1 0 i n t r o n s a n d 1 1 e xo n s , a n d t h e c o m p l e t e

CE

mRNA is 2,550 bp long, and the variant bAug10 has 9 introns and 10 exons, and the complete mRNA is 1 ,884 bp long.

The

AC

nucleotide sequence of the PCR products of hIAP (708 bp: 423-1130) is common to the two types of alternati ve splicing mRNA variants (variants aAug10 and bAug10). As shown in Fig. 4 (A), we detected these PCR products (hIAP-a and hIAP-b) from human adult small intestine total RNA by RT-PCR analysis.

The nucleotide sequences of the PCR

products (hIAP-a and hIAP-b) from human adult small intesti ne total RNA were identical to the human IAP sequence [NCBI GenBank, Accession No. NM_001631 , M31008] [Fig. 4 (B), (C)].

15

ACCEPTED MANUSCRIPT

3.5. Semi-quantitative RT-PCR analyses

IP T

Since the ALP activities of Caco-2 cells treated with 1, 25(OH)2D3 (100 nM) were significantly higher than in the control

SC R

group (0 nM), we performed RT-PCR analysis to compare the e xp r e s s i o n s o f h u m a n A L P I m R N A ( h I A P ) , h u m a n A L P I v a r i a n t aAug10 (hIAP -a), human ALPI variant bAug10 (hIAP -b), and

NU

human VDR mRNAs between the 1, 25(OH)2D3-treated group

MA

(100 nM) and control group (0 nM) (Fig. 5). On day 3, the expressions of hIAP (708 bp), hIAP-a (276

ED

bp), and hIAP-b (407 bp) in the control group (0 nM) were detected, and they were enhanced by 1, 25(OH)2D3 (100 nM) As shown in Fig. 6 (A), (B), and (C), we compared the

PT

(Fig. 5).

relative density of PCR products for h IAP, hIAP-a, and hIAP-b.

CE

The intensities of hIAP, hIAP-a, and hIAP-b expression in

AC

Caco-2 cells were significantly higher in the 1, 25(OH)2D3 -treated group (100 nM) compared with control group (0 nM) on day 3 (p<0.01, p<0.001, and p<0.05, respectively).

On day 5,

the PCR products for hIAP, hIAP-a, and hIAP-b were detected in both the 1, 25(OH)2D3 -treated group (100 nM) and control group (0 nM), and especially the PCR product s for hIAP-b were significantly enhanced by 1, 25(OH)2D3 (p<0.05) [Fig. 6 (C)]. In addition, on day 7, the intensities of hIAP-b expression in Caco-2 cells were significantly higher in the 1, 25(OH)2D3-treated group (100 n M) compared with control group 16

ACCEPTED MANUSCRIPT

(0 nM) (p<0.01) [Fig. 6 (C)].

IP T

As shown in Fig. 5, the PCR products for hVDR (207 bp) were detected in both the control group (0 n M) and 1, A s s h o wn i n

SC R

25(OH)2D3-treated group (100 n M) after day 3.

Fig. 6 (D), we compared the relative density of PCR products for h V D R , a n d t h e i n t e n s i t i e s o f h V D R e xp r e s s i o n i n C a c o - 2 c e l l s

NU

were significantly lower in the 1, 25(OH)2D3-treated group (100

ED

4. Discussion

MA

nM) compared with control group (0 n M) on day 5 (p<0.01).

PT

The data presented in this study demonstrated that ALP activity was increased significantly by 1, 25(OH)2D3 treatment,

CE

and we confirmed that the increased ALP isozyme induced by 1, 25(OH)2D3 showed similar biochemical properties to other

AC

m a m m a l i a n i n t e s t i n a l - t yp e A L P s i n h u m a n C a c o - 2 c e l l s . M o r e o ve r, w e p e r f o r m e d RT- P C R a n a l y s i s t o e x a m i n e t h e e xp r e s s i o n o f A L P i n h u m a n C a c o - 2 c e l l s .

The PCR products

for human IAP mRNA in Caco-2 cells were detected, and the i n t e n s i t i e s o f h u m a n I A P e xp r e s s i o n i n C a c o - 2 c e l l s w e r e significantly higher in the 1, 25(OH)2D3-treated group compared with control group on day 3. In human osteoblastic cells, 1, 25(OH)2D3, but not 24, 25-(OH)2D3, stimulated ALP activity and a dose-dependent increase of ALP activity was observed in response to 1, 25(OH)2D3 concentrations (0.1 -100 nM) [28]. 17

Such stimulation

ACCEPTED MANUSCRIPT

resulted in increased TNSALP mRNA expression , and 1,

in osteoblastic cells [28, 29].

IP T

25(OH)2D3 may modulate cellular differentiation and functions Human TNSALP shows 57 and and

the

SC R

52% homology with IAP and PL AP, respectively [2],

sequences predicted from cloned cDNAs encodin g ALPs reveal that IAP and PLAP show 87~90% homology at the amino acid Based on studies of hypophosphatasia, which is a

NU

level [30].

systemic skeletal disorder resulting from TNSALP deficiency,

MA

TNSALP has been shown to be indispensable for bone mineralization by controlling the concentration of inorganic pyrophosphate, a potent calcification inhibitor [31, 32].

ED

The human ALPI gene contains 10 distinct gt -ag introns. Transcription produces 2 alternati vely spliced mRNAs (variants

PT

aAug10 and bAug10).

The main variant aAug10 is 2,550 bp

CE

long, and it has been isolated from the small intestine, thalamus, rectum, ilea mucosa, and other tissues.

The variant bAug10

AC

has been obtained from the kidney and thalamus, and this complete mRNA is 1,884 bp long [17].

T h e va r i a n t b A u g 1 0

contains a 150 -bp-long upstream open reading frame (uORF),

and the efficacy of translation of the protein may be controled by the presence of a shorter translated product (uORF) initiating at an AUG upstream of the main open reading frame [17].

There has been no report on the effect of 1, 25(OH)2D3

on expression of the two types of human intestinal ALP a l t e r n a t i v e s p l i c i n g va r i a n t s i n C a c o - 2 c e l l s .

Therefore, we

designed two sets o f specific PCR primers of hIAP -a for the variant aAug10 and hIAP-b for the variant bAug10. 18

We

ACCEPTED MANUSCRIPT

detected these PCR products (hIAP -a and hIAP-b) from human

IP T

adult small intestine total RNA, and confirmed the nucleotide sequences of the PCR products (hIAP -a and hIAP-b).

As the

SC R

results, the intensities of hIAP -a and hIAP -b expression in control group were similar, and the intensities of both hIAP-a and hIAP-b expression in Caco -2 cells were significantly higher

NU

in the 1, 25(OH)2D3-treated group (100 n M) compared with control group (0 n M) on day 3.

Interestingly, on days 5 and 7,

MA

the intensities of hIAP -a expression in Caco -2 cells were not significantly higher in the 1, 25(OH)2D3-treated group compared w i t h c o n t r o l g r o u p , w h i l e t h e i n t e n s i t i e s o f h I A P - b e xp r e s s i o n i n

ED

Caco-2 cells were significantly higher in the 1, 25(OH)2D3-treated group compared with control group.

These

PT

d i f f e r e n t t i m e - c o u r s e g e n e e x p r e s s i o n p r o f i l e s o f va r i a n t s

CE

aAug10 and bAug10 suggest the importance of the transcriptional regulation of human ALPI gene expression.

AC

The differentiation in Caco-2 cells was characterized by high levels of activity of brush border -associated enzyme s, such as ALP [19].

Halline et al. reported that 1, 25(OH)2D3

significantly enhanced the norm al rise in ALP activity in Caco-2 cells [33].

W hile 1, 25(OH)2D3 decreased the proliferation of

Caco-2 cells, 1, 25(OH)2D3 qualitatively altered the differentiated phenotype [33]. P r e v i o u s l y, w e r e p o r t e d t h a t s e v e r a l d i e t a r y f a c t o r s , s u c h a s fat-feeding, vitamin K, and lactose , increased IAP activities in rodents [20, 34, 35, 36 ].

Most recently, we discovered that

human ALPI mRNA expression was significantly enhanced by 19

ACCEPTED MANUSCRIPT

vitamin K2 in Caco-2 cells [37].

After treatment with

IP T

essential fat-soluble vitamins.

Vitamin K is also one of the

menaquinone-4 (MK-4), there were significant increases in the

SC R

ALP activities of Caco -2 cells, and we discovered that human ALPI gene expression was markedly enhanced in Caco-2 cells by MK-4 [37].

NU

The vitamin D receptor (VDR) is an intracellular hor mone receptor that specifically binds to the biologically active form of

MA

vitamin D, 1, 25(OH)2D3, and interacts with specific nucleotide sequences (response elements) of target genes to produce a variety of biologic effects.

T h e r e h a ve b e e n s e v e r a l r e p o r t s

ED

that 1, 25(OH)2D3 did not enhance the human VDR mRNA level in Caco-2 cells [33, 38].

In our study, we compared the

PT

relative density of PCR products for hVDR , and the intensities

CE

of hVDR expression in Caco-2 cells were significantly weak er in the 1, 25(OH)2D3-treated group compared with control group on Although there is no classical vitamin D -responsive

AC

day 5.

element (VDRE) in the human alkaline phosphatase,

liver/bone/kidney (ALPL) gene promoter [1], Owen et al. identified an analogous VDRE sequence in the ALPL gene promoter that is exp ressed immediately after the down-regulation of proliferation during development of the osteoblast phenotype [39].

As the human ALPI gene promote r

also has no classical VDRE [2], whether the transcriptional regulation by vitamin D is mediated via VDR directly binding an analogous VDRE sequence in human ALPI gene or via VDR-independent mechanisms remains unresolved. 20

Further

ACCEPTED MANUSCRIPT

analysis of the promoter of the ALPI gene will provide useful

IP T

data for the up -regulation of the human ALPI gene expression by vitamin D.

SC R

I n t h e p r e s e n t s t u d y, w e i n v e s t i g a t e d t h e e f f e c t s o f 1 , 25(OH)2D3 at several concentrations (0 - 100 nM) in the medium according to a previous study using human osteoblastic cells However, as shown in Fig. 1, the highest level of ALP

NU

[28].

activity was observed in response to the 1, 25(OH) 2D3 Therefore, a higher concentration of

MA

concentration (100 n M).

1, 25(OH)2D3 is necessary to evaluate the effects of 1, 2 5 ( O H ) 2 D 3 o n A L P e xp r e s s i o n i n C a c o - 2 c e l l s .

ED

While we have provided new information concerning the i n f l u e n c e s o f 1 , 2 5 ( O H ) 2 D 3 o n A L P e xp r e s s i o n i n C a c o - 2 c e l l s ,

PT

further studies are necessary to confirm the influences of 1,

CE

2 5 ( O H ) 2 D 3 o n A L P e xp r e s s i o n i n g u t h o m e o s t a s i s i n o t h e r human cell lines that differentiate into small intestinal epithelial

AC

cells in vitro, or in human intestinal cells in vivo. In conclusion, our results agree with the hypothesis that 1,

25(OH)2D3 up-regulates the expression of two types of human IAP alternative splicing variants in Caco -2 cells.

Further

studies on the physiological functions of human IAP and transcriptional regulation of IAP induction will provide useful data on the novel effects of vitamin D.

Ac k n o w l e d g m e n t This work was partially supported by a JSPS Grant -in-Aid 21

ACCEPTED MANUSCRIPT

IP T

for Scientific Research (B) (Grant Number: 24300259).

SC R

REFERENCES

[ 1 ] W e i s s M J , R a y K , H e n t h o r n P S , L a m b B , K a d e s c h T, H a r r i s H . St r u c t u r e o f t h e h u m a n l i ve r / b o n e / k i d n e y a l k a l i n e

NU

phosphatase gene . J Biol Chem 1988;263:12002-10.

MA

[ 2 ] H e n t h o r n P S , R a d u c h a M , K a d e s c h T, W e i s s M J , H a r r i s H . Sequence and characterization of the human intestinal

ED

a l k a l i n e p h o s p h a t a s e g e n e . J B i o l C h e m 1 9 8 8 ; 2 6 3 : 1 2 0 11 - 9 . [3] JL Millán. Promoter structure of the human intes tinal

PT

alkaline phosphatase gene. Nucleic Acids Res 1987;15:10599.

CE

[4] Knoll BJ, Rothblum KN, Longley M. Nucleotide sequence of

AC

the human placental alkaline phosphatase gene: Evolution of the 5’ flanking region by deletion/substitution . J Biol Chem 1988;263:12020-7.

[ 5 ] G o l d b e r g R F, A u s t e n J r W G, Z h a n g X , M u n e n e G, M o s t a f a G, Biswas S, et al. Intestinal alkaline phosphatase is a gut mucosal defense factor maintained by enteral nutrition . Proc Natl Acad Sci US A 2008;105:3551-6. [6] Narisawa S, Huang L, Iwasaki A, Hasegawa H, Alpers DH, Millán JL. Accelerated fat absorption in intestinal alkaline phosphatase knockout mice . Mol Cell Biol 2003 ;23: 22

ACCEPTED MANUSCRIPT

7525-30.

IP T

[ 7 ] K a l i a n n a n K , H a m a r n e h S R , E c o n o m o p o u l o s K P, N a s r i n A l a m S , M o a v e n O , P a t e P, e t a l . I n t e s t i n a l a l k a l i n e

SC R

phosphatase prevents metabolic syndrome in mice . Proc N a t l A c a d S c i U S A 2 0 1 3 ; 11 0 : 7 0 0 3 - 8 . [ 8 ] B o t e l l a - C a r r e t e r o J I , A l v a r e z - B l a s c o F, V i l l a f r u e l a J J ,

NU

B a l s a J A , V á z q u e z C , E s c o b a r - M o r r e a l e H F. V i t a m i n D

MA

deficiency is associated with the metabolic syndrome in m o r b i d o b e s i t y. C l i n N u t r 2 0 0 7 ; 2 6 : 5 7 3 - 8 0 .

ED

[ 9 ] A s s a A , Vo n g L , P i n n e l l L J , A v i t z u r N , J o h n s o n - H e n r y K C , Sherman PM. Vitamin D deficiency promotes

PT

e p i t h e l i a l b a r r i e r d ys f u n c t i o n a n d i n t e s t i n a l i n f l a m m a t i o n . J Infect Dis 2014;210:1296-305.

CE

[ 1 0 ] N a k a o k a K , Ta n a b e R , O k u Y, Ya m a d a A , N o d a S ,

AC

Hoshino A, et al. Influences of Vitamin D Restriction on

Alkaline Phosphatase Activity in Rats Fed a High -fat Diet. J Jpn Soc Nutr Food Sci 2016;69:57-63.

[ 11 ] N a r i s a w a S , H o y l a e r t s M F, D o c t o r K S , F u k u d a M N , Alpers DH, Millán JL. A novel phosphatase up regulated in Akp3 knockout mice. Am J Physiol Gastrointest Liver Physiol 2007;293:G1068-77. [ 1 2 ] L o w e M , St r a u s s AW, A l p e r s R , S e e t h a r a m S , A l p e r s D H . Molecular cloning and expression of a cDNA encoding the membrane-associated rat intestinal alkaline 23

ACCEPTED MANUSCRIPT

phosphatase. Biochem Biophys Acta 1990 ;1037:170-7.

IP T

[ 1 3 ] St r o m M , K r i s i n g e r J , D e L u c a H F. I s o l a t i o n o f a m R N A that encodes a putative intestinal alkaline phosphatase

SC R

regulated by 1, 25 -dihydroxy vitamin D3. Biochem Biophys Acta 1991;1090:299-304.

[14] Besman M, Coleman JE. Isozymes of bovine intestinal

NU

a l k a l i n e p h o s p h a t a s e . J B i o l C h e m 1 9 8 5 ; 2 6 0 : 111 9 0 - 3 .

MA

[15] Xie Q, Alpers DH. The two isozymes of rat intestinal a l k a l i n e p h o s p h a t a s e a r e p r o d u c t s o f t wo d i s t i n c t g e n e s .

ED

Physiol Genomics 2000 ;3:1-8. [ 1 6 ] H a r a d a T, K o y a m a I , M a t s u n a g a T, K i k u n o A , K a s a h a r a T,

PT

Hassimoto M, et al. Characterization of structural and catalytic differences in rat intestinal alkaline

CE

phosphatase isozymes . FEBS J 2005;272:2477-86.

AC

[17] Homo sapiens gene ALPI, encoding al kaline phosphatase, intestinal. AceView genes database , h t t p : / / w w w. n c b i . n l m . n i h . g o v / I E B / R e s e a r c h / A c e m b l y /

a v. c g i ? d b = h u m a n & t e r m = A L P I & s u b m i t = G o ; 2 0 1 2 [accessed 16.07.01]. [ 1 8 ] P i n t o M , R o b i n e - L e o n S , A p p a y M D , K e d i n g e r M , Tr i a d o u N, Dussaulx E, et al. Enterocyte -like differentiation and polarization of the human co lon carcinoma cell line Caco-2 in culture. Biol Cell 1983;47:323-30. [19] Bessey OA, Lowry OH, Brock MJ. A method for the rapid 24

ACCEPTED MANUSCRIPT

determination of alkaline phosphata se with five cubic

IP T

millimeters of serum. J Biol Chem 1946;164:321-9. [ 2 0 ] G o s e k i - S o n e M , O i d a S , I i m u r a T, Ya m a m o t o A ,

SC R

Matsumoto HN, Omi N, et al. Expression of mRNA e n c o d i n g i n t e s t i n a l t yp e a l k a l i n e p h o s p h a t a s e i n r a t l i v e r and its increase by fat -feeding. Liver 1996;16:358-64.

NU

[ 2 1 ] S m i t h P K , K r o h n R I , H e r m a n s o n G T, M a l l i a A K , G a r t n e r FH, Provenzano MD, et al. Measurement of protein using

MA

bicinchoninic acid. Anal Biochem 1985;150:76-85. [ 2 2 ] K u r a h a s h i Y, Yo s h i k i S . E l e c t r o n m i c r o s c o p i c l o c a l i z a t i o n

ED

of alkaline phosphatase in th e enamel organ of the young rat. Arch Oral Biol 1972;17:155-63.

PT

[ 2 3 ] C h o m c z y n s k i P, S a c c h i N . S i n g l e - s t e p m e t h o d o f R N A

CE

isolation by acid guanidinium thiocyanate-phenolchloroform extraction . Anal Biochem 1987 ;162:156-9.

AC

[24] Baltes S, Nau H, Lampen A. All-trans retinoic acid enhances differentiation and influences permeabil ity of

intestinal Caco -2 cells under serum -free conditions. Dev Growth Differ 2004;46:503-14. [ 2 5 ] M o c h a r l a H , B u t c h AW, P a p p a s A A , F l i c k J T, W e i n s t e i n RS, De

To g n i

P,

et

al.

Quantification

of

vitamin

D

receptor mRNA by competitive polymerase chain reactio n in PBMC: lack of correspondence with common allelic variants. J Bone Miner Res 1997;12:726-33. [26] Smith LK. HLA typing by direct DNA sequencing. Methods 25

ACCEPTED MANUSCRIPT

Mol Biol 2012;882:67 -86.

IP T

[27] JL Millán . Mammalian Alkaline Phosphatases. Weinheim: W I L E Y- V C H ; 2 0 0 6 .

SC R

[ 2 8 ] B e r e s f o r d J N , G a l l a g h e r J A , R u s s e l l R G. 1 , 25-Dihydroxyvitamin D 3 and human bone-derived cells in vitro: effects on alkaline phosphatase, type I collagen

NU

a n d p r o l i f e r a t i o n . E n d o c r i n o l o g y 1 9 8 6 ; 11 9 : 1 7 7 6 - 8 5 .

MA

[ 2 9 ] I i m u r a T, O i d a S , I c h i j o H , G o s e k i ( - S o n e ) M , M a r u o k a Y, Ta k e d a K , e t a l . M o d u l a t i o n o f r e s p o n s e s t o T G F - b e t a b y

ED

1, 25 dihydorxyvitamin D 3 in MG-63 osteoblasitc cells: possible involvement of regulation of TGF -beta type II

PT

r e c e p t o r. B i o c h e m B i o p h y s R e s C o m m u n 1 9 9 4 ; 2 0 4 : 918-23.

CE

[30] Henthorn PS, Raducha M, Edwards YH, Weiss

AC

MJ, Slaughter C, Lafferty MA, et al. Nucleotide and amino acid sequences of human intestinal alkaline phosphatase: close homology to placental alkaline phosphatase. Proc Natl Acad Sci USA 1987;84:1234 -8.

[ 3 1 ] W h y t e M P. H y p o p h o s p h a t a s i a . I n : P e c k W A , e d i t o r s . B o n e a n d M i n e r a l R e s e a r c h . N e w Yo r k : E l s e v i e r S c i e n c e Publishers; 1989, p. 319 -22. [ 3 2 ] G o s e k i - S o n e M , O r i m o H , I i m u r a T, M i y a z a k i H , O d a K , S h i b a t a H , e t a l . E xp r e s s i o n o f t h e m u t a n t ( 1 7 3 5 T - D E L ) tissue-nonspecific alkaline phosphatase gene from 26

ACCEPTED MANUSCRIPT

h yp o p h o s p h a t a s i a p a t i e n t s . J B o n e M i n e r R e s

IP T

1998;13:1827-34. [ 3 3 ] H a l l i n e A G, D a v i d s o n N O , S k a r o s i S F, S i t r i n M D , Ti e t z e C ,

SC R

A l p e r s D H , e t a l . E f f e c t s o f 1 , 2 5 - d i h yd r o x y v i t a m i n D 3 o n proliferation and differentiation of Caco -2 cells. Endocrinology 1994;134:1710-7.

NU

[ 3 4 ] S o g a b e N , M a r u y a m a R , H o s o i T, G o s e k i - S o n e M .

MA

Enhancement effects of vitamin K 1 (phylloquinone) or vitamin K2 (menaquinone-4) on intestinal alkaline

ED

phosphatase activity in rats . J Nutr Sci Vitaminol 2007;53:219-24.

PT

[ 3 5 ] H a r a i k a w a M , S o g a b e N , Ta n a b e R , H o s o i T, Goseki-Sone M. Vitamin K1 (phylloquinone) or vitamin K 2

CE

(menaquinone -4) induces intestinal alkaline phosphatase

AC

g e n e e xp r e s s i o n . J N u t r S c i V i t a m i n o l 2 0 11 ; 5 7 : 2 7 4 - 9 .

[ 3 6 ] S o g a b e N , M i z o i L , A s a h i K , E z a wa I , G o s e k i - S o n e M . Enhancement by lactose of intestinal alkaline phosphatase expression in rats. Bone 2004;35:249 -55. [ 3 7 ] N o d a S , Ya m a d a A , Ta n a b e R , N a k a o k a K , H o s o i T, Goseki-Sone M. Menaquinone -4 (vitamin K 2) up-regulates expression of human intestinal alkaline phosphatase in Caco -2 cells. Nutr Res 2016 ;36:1269 -76. [ 3 8 ] F a n J , L i u S , D u Y, M o r r i s o n J , S h i p m a n R , P a n g K S . Up-regulation of transporters and enzymes by the vitamin D receptor ligands, 1 α ,25-dihydroxyvitamin D 3 27

ACCEPTED MANUSCRIPT

a n d v i t a m i n D a n a l o g s , i n t h e C a c o - 2 c e l l m o n o l a y e r. J

IP T

Pharmacol Exp Ther 2009;330:389 -402. [ 3 9 ] O w e n TA , B o r t e l l R , Yo c u m S A , S m o c k S L , Z h a n g M ,

SC R

Abate C, et al. Coordinate occupancy of AP -1 sites in t h e v i t a m i n D - r e s p o n s i v e a n d C C A AT b o x e l e m e n t s b y Fos-Jun in the osteocalcin gene: model for phenotype

AC

CE

PT

ED

MA

1990;87:9990-4.

NU

suppression of transcription. Proc Natl Acad Sci USA

28

ACCEPTED MANUSCRIPT

IP T

Figure legends

Fig. 1 - Effects of the 1, 25(OH)2D3 concentration on ALP C a c o - 2 c e l l s w e r e c u l t u r e d i n s e ve r a l

SC R

activity in Caco-2 cells.

concentrations of 1, 25(OH)2D3 in the medium for 1, 3, 5, and 7 Results are the means ± S.E. (n=3) from triplicate

e xp e r i m e n t s .

D u n n e t t ’s m u l t i p l e c o m p a r i s o n t e s t w a s u s e d

NU

days.

MA

a f t e r A N O VA t o c o m p a r e t h e s i g n i f i c a n c e o f d i f f e r e n c e s a m o n g 1, 25(OH)2D3 concentrations of 0, 1, 10, and 100 nM. Significant difference s between the 1, 25(OH)2D3-treated

ED

group (10 or 100 nM) and control group (0 nM) on day 3 ( **:

PT

p<0.01 and ***: p<0.001, respectively). Significant difference between the 1, 25(OH)2D3-treated group

CE

(1, 10, or 100 nM) and control group (0 nM) on day 5 ( **:

AC

p<0.01, ***: p<0.001, and ***: p<0.001, respectively). Significant difference between the 1, 25(OH)2D3-treated group (1, 10, or 100 nM) and control group (0 nM) on day 7 (***:

p<0.001).

Fig. 2 - Caco-2 cells on coverslips were stained for ALP activity on day 7.

Light micrograph of the monolayer of

confluent Caco -2 cells (x 100).

Cells were stained for ALP

activity (stained red) as described in Materials and Methods. (A)

1, 25(OH)2D3: 0 nM. 29

(B)

1, 25(OH)2D3: 1 nM.

(C)

1, 25(OH)2D3: 10 nM.

(D)

1, 25(OH)2D3: 100 nM.

IP T

ACCEPTED MANUSCRIPT

SC R

Bar=100 µm

Fig. 3 - The genomic organization and structure of

NU

a l t e r n a t i v e l y s p l i c e d t r a n s c r i p t s o f h u m a n I A P.

MA

The human ALPI gene (NCBI, GenBank Accession No.J03930 ) is located on chromosome 2 [2], and it contains 10 distinct It was reported that transcription produces 2

ED

introns.

alternatively spliced mRNAs [variant aAug10 (NM_001631)

PT

and variant bAug10 (M31008)] (NCBI, AceView) from the human ALPI gene [17].

The m ain ALPI variant aAug10 is

CE

2,550 bp long, and the variant bAug10 is 1,884 bp long.

The

AC

2 spliced mRNAs putatively encode proteins (528 and 438 amino acids, respectively), comprising 2 different isoforms,

containing the ALP domain and some transmembrane do mains. E xo n s a r e d e p i c t e d a s c l o s e d b o xe s .

It also shows the

l o c a t i o n o f t h e P C R p r o d u c t ( h I A P - a o r h I A P - b ) f o r t h e va r i a n t aAug10 or bAug10.

The nucleotide sequence of the PCR

products of hIAP (708 bp: 423 -1,130) is common to the two t yp e s o f a l t e r n a t i v e s p l i c i n g m R N A v a r i a n t s ( v a r i a n t s a A u g 1 0 and bAug10).

30

ACCEPTED MANUSCRIPT

Fig. 4 -

IP T

( A) D e t e c t i o n b y RT- P C R o f R N A s o f t h e va r i a n t s a A u g 1 0 a n d bAug10 in the human adult small intestine using specific The PCR products [hIAP-a (276 bp) and hIAP-b (407

SC R

primers.

bp)] were electrophoresed in a 5.25% polyacrylamide gel. (B) The nucleotide se quence of the PCR product (hIAP-a)

NU

from the human small intestine using the specific primers for

MA

t h e v a r i a n t a A u g 1 0 wa s c o m p a r e d w i t h t h e h u m a n A L P I m R N A sequence [NCBI GenBank Accession No. NM_001631] (top

ED

sequence).

The nucleotide sequences of the primer s are underlined.

PT

Matches between the two sequences are marked by asterisks. T h e A i n t h e AT G o f t h e i n i t i a t o r M e t c o d o n i s d e n o t e d a s

CE

nucleotide +1.

AC

(C) The nucleotide se quence of the PCR product (hIAP-b) from the human small intestine using the specific pr imers for the variant bAug10 was compared with the human ALPI mRNA sequence [NCBI GenBank Accession No. M31008] (top sequence). The nucleotide sequences of the primers are underlined. Matches between the two sequences are marked by asterisks. T h e A i n t h e AT G o f t h e i n i t i a t o r M e t c o d o n i s d e n o t e d a s nucleotide +1. 31

ACCEPTED MANUSCRIPT

IP T

F i g . 5 - D e t e c t i o n b y RT- P C R o f m R N A s f o r h I A P, h I A P - a , hIAP-b, hVDR, or GAPDH in Caco -2 cells.

The PCR products

SC R

were electrophoresed in a 5.25% polyacrylamide gel. hIAP: human intestinal alkaline phosphatase, hVDR: human v i t a m i n D r e c e p t o r, G A P D H : g l y c e r a l d e h y d e - 3 - p h o s p h a t e

MA

NU

dehydrogenase.

F i g . 6 - T h e r e l a t i v e e x p r e s s i o n l e v e l s o f m R N A f o r h I A P,

ED

hIAP-a, hIAP-b, or hVDR in Caco-2 cells.

All values are

normalized to the housekeeping gene GAPDH.

Results are

PT

the means ± S.E. (n=3) from triplicate experiments. Comparisons between the 1, 25(OH)2D3-treated group (100

CE

nM) and control group (0 n M) were performed using the

AC

u n p a i r e d t w o - t a i l e d St u d e n t ’s t - t e s t . (A) The relative expression level of mRNA for hIAP in Caco -2 cells.

Significant difference between the 1, 25(OH)2D3

-treated group (100 nM) and control group (0 nM) on day 3 (**: p<0.01). (B) The relative expression level of mRNA for hIAP-a in Caco-2 cells.

Significant difference between the 1,

25(OH)2D3-treated group (100 n M) and control group (0 nM) on day 3 (***: p<0.001). (C) The relative expression levels of mRNA for hIAP-b in 32

ACCEPTED MANUSCRIPT

Caco-2 cells.

Significant difference betwe en the 1,

IP T

25(OH)2D3-treated group (100 nM) and control group (0 nM) on days 3, 5, and 7 (*: p<0.05, *: p<0.05, and **: p<0.01,

SC R

respectively).

(D) The relative expression levels of mRNA for hVDR in Caco -2 cells.

Significant difference between the 1, 25(OH)2D3

NU

-treated group (100 nM) and control group (0 nM) on day 5

MA

(**: p<0.01).

hIAP: human intestinal alkaline phosphatase, h VDR: human

AC

CE

PT

ED

v i t a m i n D r e c e p t o r.

33

NU

12

10

MA

8

2

10 nM

***

***

**

100 nM ***

***

***

*** **

ED

6

1 nM

PT

Alkaline phosphatase activity (mU/mL)

14

4

0 nM

SC R

Initial

IP T

ACCEPTED MANUSCRIPT

AC

CE

0

Day 0 0

Day 11

F ig . 1 .

34

Day 33

Day 5 5

Day 7 7

IP T

ACCEPTED MANUSCRIPT

(A)

MA

NU

SC R

(B)

(D)

AC

CE

PT

ED

(C)

F ig . 2 .

35

ACCEPTED MANUSCRIPT

hIAP

Va ri ant bA ug 10 1 (1, 88 4 b p)

ED

9

9 10

(42 3 ~1 , 13 0)

F ig . 3 .

AC

36

11 hIAP -a

1

(2, 10 1~2,3 76 ) 11

0

11 b

hIAP

CE

PT

(118 ~52 4)

4

MA

2 3 4 1b

hIAP -b

3

SC R

2

9 10

NU

ALPI ge ne 1

IP T

(42 3 ~1, 13 0) Va r i a n t a A u g 1 0 1 2 3 4 (2,550 bp)

Ex o n Intr o n

SC R

IP T

ACCEPTED MANUSCRIPT

27 6 b p

AC

CE

PT

ED

MA

hIAP -a

NU

(A)

F ig . 4 .

37

hIAP -b

40 7 b p

AC

CE

PT

ED

MA

NU

SC R

IP T

ACCEPTED MANUSCRIPT

F ig . 4 .

38

0 5

IP T

ACCEPTED MANUSCRIPT

100

0 7

100

nM

nM

nM

nM

Da y

hIAP

0 3

100

nM

nM

SC R

Da y

NU

hIAP -a

MA

hIAP -b

GAP D

F ig . 5 .

AC

CE

27 6 b p 40 7 b p

45 2 b p

PT

H

70 8 b p

20 7 b p

ED

hV DR

Da y

39

AC

CE

PT

ED

MA

NU

SC R

IP T

ACCEPTED MANUSCRIPT

F ig . 6 .

40

IP T

ACCEPTED MANUSCRIPT

SC R

Table 1 - Inhibitory effects on alkaline phosphatase of

NU

Caco-2 cells (%)

Levamisole concentrations

0 nM

ED

Caco-2 cells

ine

inactivation (56℃ 10

(1 mM)

(20 mM)

55.7±1.2

18.0±2.8

99.7±0.3

58.2±2.7

16.7±1.5

99.8±0.1

min)

PT

100 nM

Heat

MA

1, 25(OH)2D3

L-phenylalan

ALP activity was assayed by the rate of hydrolysis of

CE

p-nitro-phenylphosphate. The effects of the inhibitor were determined in the presence

AC

of 5 mM MgCl2 in the assay mixture. Activities of non-treated controls were designated as 100%.

Cultured cells were treated with 1, 25(OH)2D3 (0 or 100 nM)

for 7 days. Each value represents the means ± S.E. (n=3) of triplicate experiments. The unpaired two-tailed Student’ s t-test was used to compare the significance of differences between 1, 25(OH)2D3 concentrations of 0 and 100 nM.

41